ID: 1074768182

View in Genome Browser
Species Human (GRCh38)
Location 10:116716028-116716050
Sequence CAGCTGAGCAGCTCCCACTC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1074768174_1074768182 19 Left 1074768174 10:116715986-116716008 CCACTGGCCCCCTCGCAGATGAC 0: 1
1: 0
2: 1
3: 11
4: 135
Right 1074768182 10:116716028-116716050 CAGCTGAGCAGCTCCCACTCTGG No data
1074768177_1074768182 10 Left 1074768177 10:116715995-116716017 CCCTCGCAGATGACAAAACAGAT 0: 1
1: 0
2: 2
3: 11
4: 134
Right 1074768182 10:116716028-116716050 CAGCTGAGCAGCTCCCACTCTGG No data
1074768173_1074768182 20 Left 1074768173 10:116715985-116716007 CCCACTGGCCCCCTCGCAGATGA 0: 1
1: 0
2: 1
3: 6
4: 75
Right 1074768182 10:116716028-116716050 CAGCTGAGCAGCTCCCACTCTGG No data
1074768178_1074768182 9 Left 1074768178 10:116715996-116716018 CCTCGCAGATGACAAAACAGATG 0: 1
1: 0
2: 0
3: 7
4: 149
Right 1074768182 10:116716028-116716050 CAGCTGAGCAGCTCCCACTCTGG No data
1074768176_1074768182 11 Left 1074768176 10:116715994-116716016 CCCCTCGCAGATGACAAAACAGA No data
Right 1074768182 10:116716028-116716050 CAGCTGAGCAGCTCCCACTCTGG No data
1074768175_1074768182 12 Left 1074768175 10:116715993-116716015 CCCCCTCGCAGATGACAAAACAG 0: 1
1: 0
2: 4
3: 49
4: 392
Right 1074768182 10:116716028-116716050 CAGCTGAGCAGCTCCCACTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1074768182 Original CRISPR CAGCTGAGCAGCTCCCACTC TGG Intronic
No off target data available for this crispr