ID: 1074768185

View in Genome Browser
Species Human (GRCh38)
Location 10:116716034-116716056
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1074768177_1074768185 16 Left 1074768177 10:116715995-116716017 CCCTCGCAGATGACAAAACAGAT No data
Right 1074768185 10:116716034-116716056 AGCAGCTCCCACTCTGGGATGGG No data
1074768174_1074768185 25 Left 1074768174 10:116715986-116716008 CCACTGGCCCCCTCGCAGATGAC No data
Right 1074768185 10:116716034-116716056 AGCAGCTCCCACTCTGGGATGGG No data
1074768175_1074768185 18 Left 1074768175 10:116715993-116716015 CCCCCTCGCAGATGACAAAACAG No data
Right 1074768185 10:116716034-116716056 AGCAGCTCCCACTCTGGGATGGG No data
1074768176_1074768185 17 Left 1074768176 10:116715994-116716016 CCCCTCGCAGATGACAAAACAGA No data
Right 1074768185 10:116716034-116716056 AGCAGCTCCCACTCTGGGATGGG No data
1074768178_1074768185 15 Left 1074768178 10:116715996-116716018 CCTCGCAGATGACAAAACAGATG No data
Right 1074768185 10:116716034-116716056 AGCAGCTCCCACTCTGGGATGGG No data
1074768179_1074768185 -9 Left 1074768179 10:116716020-116716042 CCAGCCACCAGCTGAGCAGCTCC No data
Right 1074768185 10:116716034-116716056 AGCAGCTCCCACTCTGGGATGGG No data
1074768173_1074768185 26 Left 1074768173 10:116715985-116716007 CCCACTGGCCCCCTCGCAGATGA No data
Right 1074768185 10:116716034-116716056 AGCAGCTCCCACTCTGGGATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type