ID: 1074768703

View in Genome Browser
Species Human (GRCh38)
Location 10:116719311-116719333
Sequence AGGGTACTCACTTAAAAGGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 103
Summary {0: 1, 1: 0, 2: 1, 3: 3, 4: 98}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1074768703_1074768708 -10 Left 1074768703 10:116719311-116719333 CCCGCCTTTTAAGTGAGTACCCT 0: 1
1: 0
2: 1
3: 3
4: 98
Right 1074768708 10:116719324-116719346 TGAGTACCCTGAGAAGAGGGTGG No data
1074768703_1074768712 0 Left 1074768703 10:116719311-116719333 CCCGCCTTTTAAGTGAGTACCCT 0: 1
1: 0
2: 1
3: 3
4: 98
Right 1074768712 10:116719334-116719356 GAGAAGAGGGTGGACGCACAGGG No data
1074768703_1074768714 8 Left 1074768703 10:116719311-116719333 CCCGCCTTTTAAGTGAGTACCCT 0: 1
1: 0
2: 1
3: 3
4: 98
Right 1074768714 10:116719342-116719364 GGTGGACGCACAGGGGCGTGAGG No data
1074768703_1074768713 1 Left 1074768703 10:116719311-116719333 CCCGCCTTTTAAGTGAGTACCCT 0: 1
1: 0
2: 1
3: 3
4: 98
Right 1074768713 10:116719335-116719357 AGAAGAGGGTGGACGCACAGGGG No data
1074768703_1074768711 -1 Left 1074768703 10:116719311-116719333 CCCGCCTTTTAAGTGAGTACCCT 0: 1
1: 0
2: 1
3: 3
4: 98
Right 1074768711 10:116719333-116719355 TGAGAAGAGGGTGGACGCACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1074768703 Original CRISPR AGGGTACTCACTTAAAAGGC GGG (reversed) Intronic
900504993 1:3025421-3025443 CAGGTCCTCCCTTAAAAGGCTGG - Intergenic
904202756 1:28832033-28832055 AGGGGCCTCAGTTCAAAGGCTGG - Intronic
905938932 1:41847645-41847667 AGGGCAGGCACTAAAAAGGCGGG + Intronic
907545410 1:55255443-55255465 AGGGTACTCTCTTGCAATGCCGG + Intergenic
908217974 1:61974767-61974789 AGGGTACTCAGTTACAAAACTGG + Intronic
912784855 1:112591225-112591247 AGGGTACTAACATACTAGGCCGG - Intronic
919058668 1:192603255-192603277 AAGTTACTCAGTTACAAGGCTGG - Intergenic
921677751 1:217995181-217995203 AGGGCACTAAATTAAATGGCTGG - Intergenic
923601872 1:235410709-235410731 AGGGTTCTCTCGTAAAAGGGAGG - Intronic
1064065432 10:12177211-12177233 AGGGCAATTACTCAAAAGGCTGG + Intronic
1065591677 10:27268709-27268731 AGGTTACTCACATCAAGGGCTGG - Intergenic
1065659334 10:27989487-27989509 AGGTTACTCACATCAAGGGCTGG + Intronic
1070546483 10:77456819-77456841 AGGGGACTCTCCTAACAGGCTGG + Intronic
1074075461 10:110119807-110119829 ATTGTACTAACTTAAAAAGCAGG - Intronic
1074768703 10:116719311-116719333 AGGGTACTCACTTAAAAGGCGGG - Intronic
1077274977 11:1700552-1700574 AGGGAGCTCACATTAAAGGCTGG - Intergenic
1080061159 11:27958437-27958459 AGGGTCCTCACTTTATAGACTGG + Intergenic
1083499709 11:63093161-63093183 ATGGTACTCATTAAAAAGTCAGG + Intronic
1085911105 11:80827800-80827822 AGGATACTCGCTTAAAACACAGG + Intergenic
1087524772 11:99295992-99296014 AGGTTATTCATTTATAAGGCTGG + Intronic
1087931946 11:103987940-103987962 AAGGTACACAATTATAAGGCAGG - Intronic
1088918142 11:114242557-114242579 AGGATGCTCATTAAAAAGGCAGG + Intronic
1092702583 12:11248568-11248590 AGGGTTCTCACTTCAAAGCATGG - Intergenic
1100715507 12:97301383-97301405 TGGTCACTCACTTTAAAGGCTGG - Intergenic
1109742709 13:66575536-66575558 AGCGTACTCACTGAAGAGGAAGG - Intronic
1110619477 13:77578863-77578885 AGTGTGCTCAGGTAAAAGGCAGG + Intronic
1113609654 13:111634906-111634928 AGGGTGGTCACTGAAAAGGGAGG + Intronic
1114998743 14:28394043-28394065 AAGGTACTCATTTACAAGCCAGG - Intergenic
1122476084 14:102010075-102010097 AGGCTACTTACTTAAAAAACGGG - Exonic
1137915466 16:52425062-52425084 AATGTCCTCACATAAAAGGCAGG + Intergenic
1143851998 17:9819995-9820017 AGGATAATCACTTAAAACCCAGG + Intronic
1144201972 17:12949719-12949741 GGGGTACTCACTTGGAAGCCTGG - Exonic
1149339894 17:55674413-55674435 AGATTTCTCACTTAAGAGGCAGG - Intergenic
1151178411 17:72307999-72308021 GGGATACTCACGTAACAGGCTGG - Intergenic
1154256628 18:12786761-12786783 AGGCTACTCCCTTTAAAGACAGG + Intronic
1155079972 18:22399421-22399443 GGGGTACTACCTTAAATGGCGGG + Intergenic
1157725047 18:49957868-49957890 AGGGTACTCCTTAAAGAGGCTGG - Intronic
1158808364 18:61002270-61002292 AGAGTCCTCTCTTAAAAGACTGG - Intergenic
1160442808 18:78905186-78905208 AGGGTACTCTATTTAAAGGAGGG + Intergenic
1160466255 18:79079330-79079352 ATGGTAATCACTAAAAAGTCAGG - Intronic
1162066390 19:8127887-8127909 AGGATAATCTCTTAAACGGCGGG + Intronic
1168617549 19:57850666-57850688 AGAATACGCATTTAAAAGGCGGG + Intronic
925360710 2:3278420-3278442 AGGGTACTCTCTCAGAGGGCTGG - Intronic
926303547 2:11620776-11620798 AGGGTTCTCATTTTAAAGACAGG + Intronic
932378381 2:71259034-71259056 AGGGTTCTAACTAAAAAGCCAGG + Intergenic
934107713 2:88710978-88711000 AGGGAACTCTCATAATAGGCTGG - Intronic
937724845 2:125150250-125150272 AGGGCAATCACTAAAAAGTCAGG - Intergenic
941622953 2:167799070-167799092 AGGGTACTCACTGAAATCACAGG - Intergenic
948576319 2:238952795-238952817 AGTGTACTCACTAGAGAGGCTGG - Intergenic
1174281039 20:49439509-49439531 AGGGTACACAGTTAAAAAGGGGG + Intronic
1178686088 21:34711747-34711769 AGGATACTGACTTGAAATGCAGG + Intronic
1181103247 22:20555453-20555475 AGGGTTCTCAGCTACAAGGCAGG + Intronic
1182117907 22:27767910-27767932 CGGGTCCTCCCTTCAAAGGCAGG + Intronic
951604599 3:24419202-24419224 AGGGTACTCAGTGAGAAGGGAGG - Intronic
961629046 3:128282966-128282988 AGGCTACTCACTTAAAAGGGAGG - Intronic
963407823 3:144890179-144890201 AGGGGGCTAACTTATAAGGCTGG + Intergenic
963731281 3:148975596-148975618 ATGGTACTCATTTAAACGTCTGG + Intergenic
964938010 3:162118064-162118086 AGGGGACTTACTTATCAGGCTGG + Intergenic
967943964 3:194787485-194787507 AGGGCACTTCCTTAAAAGGAAGG + Intergenic
967957085 3:194885621-194885643 AGGTTAATCACTAAAAATGCAGG - Intergenic
971178774 4:24307822-24307844 TGGGTATTCATTTAAAAAGCAGG - Intergenic
974003779 4:56535835-56535857 AGGGTTCTCACCTCTAAGGCAGG + Intronic
978550076 4:109915903-109915925 AGAATACTCAGTTAAAAGGAGGG - Intronic
979567689 4:122174139-122174161 AAGGTACTCAATTATAAGGCAGG - Intronic
981573397 4:146177228-146177250 AGAGTACTCACTTGGGAGGCAGG - Intronic
981681244 4:147401219-147401241 AGGGTGTTCACCTGAAAGGCAGG - Intergenic
982577300 4:157130406-157130428 AGGGTAAGCACTTAAAGGGCTGG - Intronic
986718317 5:10539926-10539948 AGGGCAGTCACCTACAAGGCAGG - Intergenic
987870000 5:23603852-23603874 AGGGTACTCGATTTAAACGCTGG - Intergenic
988387400 5:30582955-30582977 AAGGTAGTCATTTGAAAGGCTGG - Intergenic
990290855 5:54349973-54349995 AGGTTATTCACGTATAAGGCTGG - Intergenic
992578188 5:78141803-78141825 AGGGTTCTTACTAAAAAGACAGG + Intronic
1000415909 5:160983647-160983669 AGGGTTCTCTTTTAAAAGGGAGG + Intergenic
1004489683 6:16102645-16102667 AGGCTATTATCTTAAAAGGCAGG + Intergenic
1006033936 6:31197565-31197587 AGGATCCTCACTGAAAGGGCGGG + Intergenic
1006861769 6:37176369-37176391 AGGATAATCACTTAAAACCCGGG - Intergenic
1008800604 6:55364106-55364128 ATGGCAATCATTTAAAAGGCAGG - Intronic
1008810825 6:55496495-55496517 AGGGTATCCACTTAAAATCCTGG + Intronic
1009823197 6:68831251-68831273 AGGCTACTCACTTAGGCGGCGGG + Intronic
1010681247 6:78801777-78801799 ATGGTGATCACTAAAAAGGCAGG - Intergenic
1012422109 6:99077069-99077091 AGGGTCCTCCTTTCAAAGGCGGG + Intergenic
1013301283 6:108807185-108807207 AGAGTACTAACTAAAAAGGTTGG - Intergenic
1016880728 6:148909720-148909742 AAAGTAATCACTTAGAAGGCAGG - Intronic
1021480922 7:21115769-21115791 CGGGTGCTCACCTTAAAGGCAGG + Intergenic
1031354168 7:120769539-120769561 AAGGTACACATTTATAAGGCTGG + Intergenic
1032027096 7:128452214-128452236 TGGGTACTCACTGAAGATGCTGG + Intergenic
1037119870 8:15270108-15270130 AGGGTACTCAGTAAAATTGCTGG + Intergenic
1040496203 8:47967640-47967662 ATGGTACTCAGTTAAAAAGGTGG - Intronic
1040684847 8:49859707-49859729 AGGTCCCTCACTTAAGAGGCTGG - Intergenic
1040752017 8:50721635-50721657 AGGGAAATCACTAAAAAGGTAGG + Intronic
1045840997 8:106580866-106580888 AGTGAACACACTTGAAAGGCTGG - Intronic
1050343557 9:4664015-4664037 AGAGGAATCACTTAAAAGGTAGG + Exonic
1051147831 9:14047675-14047697 AGGATACTCTCTTAAAAATCTGG + Intergenic
1055182873 9:73410718-73410740 AGGATACTCTCTTAGATGGCTGG + Intergenic
1059587565 9:115622174-115622196 AAGGTACTAACTTAAAAAGCTGG + Intergenic
1060347001 9:122825960-122825982 AGGTTCCTCTCTTAAAAAGCTGG - Intronic
1189380849 X:40501082-40501104 AGTTTCCTCCCTTAAAAGGCAGG - Intergenic
1191844351 X:65535264-65535286 CTGGTACTAATTTAAAAGGCAGG - Intergenic
1194544367 X:95214528-95214550 ATGGTAATCACTAAAAAGTCAGG + Intergenic
1195559807 X:106270206-106270228 AGGGTAGGCACTTACCAGGCTGG + Intergenic
1195562154 X:106296133-106296155 AGGGTAGGCACTTACCAGGCTGG - Intergenic
1201783935 Y:17752933-17752955 AGAATAAGCACTTAAAAGGCGGG + Intergenic
1201817618 Y:18153054-18153076 AGAATAAGCACTTAAAAGGCGGG - Intergenic