ID: 1074769921

View in Genome Browser
Species Human (GRCh38)
Location 10:116726575-116726597
Sequence CAGAAGGAACTGTGGGAAAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 524
Summary {0: 1, 1: 0, 2: 2, 3: 42, 4: 479}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1074769921_1074769933 11 Left 1074769921 10:116726575-116726597 CCAATTTCCCACAGTTCCTTCTG 0: 1
1: 0
2: 2
3: 42
4: 479
Right 1074769933 10:116726609-116726631 CAAACCACCAGGCCCAAGAGGGG No data
1074769921_1074769929 0 Left 1074769921 10:116726575-116726597 CCAATTTCCCACAGTTCCTTCTG 0: 1
1: 0
2: 2
3: 42
4: 479
Right 1074769929 10:116726598-116726620 GGGGTGCCTGTCAAACCACCAGG No data
1074769921_1074769931 9 Left 1074769921 10:116726575-116726597 CCAATTTCCCACAGTTCCTTCTG 0: 1
1: 0
2: 2
3: 42
4: 479
Right 1074769931 10:116726607-116726629 GTCAAACCACCAGGCCCAAGAGG No data
1074769921_1074769932 10 Left 1074769921 10:116726575-116726597 CCAATTTCCCACAGTTCCTTCTG 0: 1
1: 0
2: 2
3: 42
4: 479
Right 1074769932 10:116726608-116726630 TCAAACCACCAGGCCCAAGAGGG No data
1074769921_1074769934 12 Left 1074769921 10:116726575-116726597 CCAATTTCCCACAGTTCCTTCTG 0: 1
1: 0
2: 2
3: 42
4: 479
Right 1074769934 10:116726610-116726632 AAACCACCAGGCCCAAGAGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1074769921 Original CRISPR CAGAAGGAACTGTGGGAAAT TGG (reversed) Intronic
900841037 1:5048777-5048799 AAGAAGGAAATGTGGGGAAATGG - Intergenic
902328812 1:15720402-15720424 CAGAAGGAACTCAGAGAAATCGG - Intronic
902375797 1:16029397-16029419 CAGAAGGAAGTGTGGGTGAGAGG - Intronic
902446906 1:16472918-16472940 AAGAAGGAACCTTGGGACATCGG - Intergenic
903193388 1:21668881-21668903 GAGGAGGGACTGTGGGAAGTGGG - Intronic
903534000 1:24054513-24054535 AAAAAGGAACTGTTGTAAATGGG - Intergenic
905008621 1:34731250-34731272 CAGAGGGAACAGTGGGAGAGAGG - Intronic
905750398 1:40457572-40457594 AAGATGGAAGTGTGGGAAAAGGG - Intronic
905851857 1:41280553-41280575 CAGGAGGAGCTCTGGGGAATGGG + Intergenic
906055806 1:42915929-42915951 TAAATGGAACTGTGGTAAATAGG - Intergenic
908163474 1:61434899-61434921 CACTTGGAACTGTGGGAAAAGGG + Intronic
909729743 1:78876595-78876617 AAGAAGGAAATATGGGAAAATGG - Intergenic
910107499 1:83647238-83647260 CACATGGCACTGTGGGCAATGGG + Intergenic
910365095 1:86456665-86456687 GAGAGGGAAATGTGGGGAATTGG + Intergenic
911123492 1:94319096-94319118 TAGAAGGAAGTTTGGGAAAGGGG + Intergenic
911136065 1:94442255-94442277 CAGACGGAATTCTGGGAAAACGG - Intronic
911373160 1:97018380-97018402 CAAAAGAAACTGTTGTAAATAGG - Intergenic
911599241 1:99830449-99830471 CTGGAGAAACTGTGGGAATTGGG - Intergenic
912296719 1:108476865-108476887 AAGAAGGAAATGTGGGGAAATGG - Intergenic
913092174 1:115483865-115483887 GAAAAGGAACTGAGGTAAATAGG - Intergenic
913328379 1:117647276-117647298 CAAAAGGCACAGTGGGACATGGG - Intergenic
913408827 1:118527571-118527593 GAGAATGAAATGTGGGGAATGGG + Intergenic
915861743 1:159452010-159452032 TAGAAGAGACTGTGGAAAATTGG - Intergenic
916073448 1:161185888-161185910 CAGAAGGGACTTTAGGAAATTGG + Exonic
916206346 1:162319492-162319514 CAGAAGGACTGGTGGGAGATGGG - Intronic
916943760 1:169703316-169703338 CAGAAGGAACTGAGTTAATTGGG - Exonic
917027397 1:170659292-170659314 CAGAAGGAATGGTTGGAAAGTGG + Intergenic
917429744 1:174953746-174953768 CAGCAGACACTGTGGGAGATCGG + Intronic
917839991 1:178969758-178969780 CACAAGGAACTCTGGGAAAGGGG + Intergenic
918485251 1:185022081-185022103 TAAAAGGAACTGAGGTAAATAGG - Intergenic
919030477 1:192235797-192235819 CAGGAGGAACAGTCTGAAATTGG - Intergenic
919476648 1:198038661-198038683 AAGAAGGAAATGTGGGGAAATGG - Intergenic
919508927 1:198436039-198436061 CAGGAGAGACTGTGAGAAATAGG - Intergenic
919747843 1:201019841-201019863 CAGAAGAAACTGTGGGGGAATGG - Intronic
920608632 1:207415075-207415097 AGGAAGGAAATGGGGGAAATTGG + Intergenic
921707017 1:218333926-218333948 TAGAAAGAACTATGGAAAATAGG + Exonic
921849958 1:219924446-219924468 TAGAAGGACCTTAGGGAAATTGG - Intronic
922048661 1:221969865-221969887 AAGAAGGAAATGTGGGGAAATGG - Intergenic
922089756 1:222384658-222384680 CAGAAGGCCCTTTGGGAACTTGG - Intergenic
922533945 1:226365922-226365944 CAGAAGGAAGTGGGGGAAGAAGG + Intronic
923164836 1:231350119-231350141 CAGAAGGGACTGAAGGACATAGG - Intronic
923335231 1:232963545-232963567 CAGAAGGAAATGCTGGAAATGGG - Intronic
923651753 1:235880513-235880535 CAGAAAGAACCATGGGAAGTGGG + Intronic
923745889 1:236700001-236700023 CAGAGGCAGCTGTGGGAAGTAGG - Intronic
924180950 1:241438109-241438131 AAGAAGGAAATGTGGGGAAATGG - Intergenic
924232185 1:241971448-241971470 CAGAAGGGTCTATAGGAAATGGG - Intergenic
924303823 1:242666492-242666514 CAGAAGCCACTATGGGACATAGG + Intergenic
924309463 1:242725138-242725160 CAGAAGGCACTGTGGGAGAAAGG + Intergenic
924352896 1:243135596-243135618 CAGAAGGAAATGTAGAAAGTTGG - Intronic
1063976073 10:11416579-11416601 TATAAGGAACTGTGGTAAATAGG - Intergenic
1064581791 10:16800142-16800164 TAAAAGGAACTGAGGTAAATAGG - Intronic
1065382652 10:25105060-25105082 CAGAAAGAACTCTGTGAAACTGG - Intergenic
1065662238 10:28018065-28018087 CAGAAGGGATTCTGGGAAAAAGG - Intergenic
1066439559 10:35425198-35425220 CACAAAGTGCTGTGGGAAATGGG - Intronic
1067061957 10:43082195-43082217 CAGGAGGAGCTGTGGGAACAAGG - Intronic
1068080592 10:52313998-52314020 CAGCAGGAACTCTGGGAACTTGG - Intergenic
1068885614 10:62093626-62093648 GAGAAGGAACTGGGAGAAAATGG - Exonic
1069579637 10:69556844-69556866 CACATGGTACAGTGGGAAATTGG + Intergenic
1069647264 10:70009717-70009739 TAAAAGGAACTGAGGTAAATAGG - Intergenic
1069667642 10:70174163-70174185 CAGAAGGAGTGGTAGGAAATGGG + Intergenic
1070706433 10:78642470-78642492 CAGAAGCACCTGTGGGCAAGTGG + Intergenic
1071078448 10:81782275-81782297 CAGAAGGGGCTGTGGGAAGCAGG - Intergenic
1071961383 10:90811435-90811457 GAGAAGGAAATGTGGGGAAATGG - Intronic
1073474216 10:103742360-103742382 CAGAAGGAGATGTGGGACACAGG - Intronic
1074177448 10:111023270-111023292 TAAAAGGAACTGAGGTAAATAGG - Intergenic
1074769921 10:116726575-116726597 CAGAAGGAACTGTGGGAAATTGG - Intronic
1076524192 10:131100966-131100988 CAGAAGGTCCAGTGGGAAAGAGG - Intronic
1077578836 11:3404274-3404296 CAGCAGTAACTGTGGGACAGGGG - Intergenic
1077588494 11:3473070-3473092 AAGAAGGAAATGTGGGGAAATGG + Intergenic
1078184249 11:9038337-9038359 CAGAATAAAATGTGGGAAACAGG + Intronic
1079103817 11:17558103-17558125 CAGAAGGCTCTGAGGGAAAGCGG - Intronic
1079292496 11:19200832-19200854 CAGCACGAAGAGTGGGAAATTGG - Intronic
1079440982 11:20514700-20514722 CAGAATGAACTGTGAGACCTGGG - Intergenic
1080159739 11:29159633-29159655 CAGAAGCCACTGTGGGACAGTGG - Intergenic
1080229721 11:30005970-30005992 AAGAAGATACTGTGAGAAATTGG + Intergenic
1081555770 11:44159722-44159744 TGAAAGGAACTCTGGGAAATAGG + Intronic
1083674336 11:64317139-64317161 CAGACGCAACTGTGGGCAAGAGG + Exonic
1084235860 11:67787791-67787813 CAGCAGTAACTGTGGGACAGGGG - Intergenic
1084828493 11:71749864-71749886 AAGAAGGAAATGTGGGGAAATGG - Intergenic
1085332299 11:75663739-75663761 CAAAAGGAAATTAGGGAAATGGG + Intronic
1085596724 11:77818383-77818405 GAGAACGAACTGTGGGCATTTGG - Intronic
1085731988 11:79007796-79007818 CTGAAAGAACAGTGGGAAGTTGG + Intronic
1086052505 11:82610121-82610143 CAGAAGGAAAGGAGGGAAAGAGG + Intergenic
1087099917 11:94353767-94353789 AAGAAGGAAATGTGGGGAAATGG - Intergenic
1087197168 11:95313438-95313460 AAGAAGGAAATGTGGGGAAATGG - Intergenic
1087361770 11:97169671-97169693 CAAAAGGAACTCCAGGAAATGGG - Intergenic
1089645134 11:119873968-119873990 CAGAAGCCCCTGTGGGCAATGGG + Intergenic
1089866792 11:121639708-121639730 AAGAAGGAAATGTGGGGAAATGG + Intergenic
1089888358 11:121853971-121853993 CAAAACGAACTGTGGAAAATTGG + Intergenic
1089953621 11:122551255-122551277 AAGAAGGAAATGTGGGGAAATGG - Intergenic
1090526523 11:127544311-127544333 AAGAAGGAAATGTGGGGAAATGG + Intergenic
1090556012 11:127877147-127877169 CAGAAGGCAATGTGGTAAATAGG + Intergenic
1090571822 11:128055586-128055608 TGGAAGGGACTGGGGGAAATGGG - Intergenic
1090926680 11:131256279-131256301 AAGAAGGAAATGTGGGGAAATGG + Intergenic
1091021229 11:132101971-132101993 CTGTAGGAATGGTGGGAAATGGG - Intronic
1091028101 11:132159901-132159923 TAGTAGGAACTGTGTCAAATAGG + Intronic
1091876090 12:3934077-3934099 TAGAAGGAACTGCTGTAAATAGG - Intergenic
1092122388 12:6053585-6053607 CAGAAGGAAGTGTAGCAAAGTGG + Intronic
1092474739 12:8808847-8808869 AAGAAGGAAATGTGGGGAAATGG - Intergenic
1092924536 12:13261374-13261396 AAGAAGGAAATGTGGGGAAATGG + Intergenic
1093358741 12:18199251-18199273 AAGAAGGAAATGTGGGGAAATGG - Intronic
1093579070 12:20767292-20767314 AAGAAGGAAATGTGGGGAAATGG - Intergenic
1094359493 12:29614972-29614994 CAGAAGGAACTGTGGTGGACTGG + Intronic
1094499398 12:31008841-31008863 CACAGGGAACTCAGGGAAATGGG - Intergenic
1094826048 12:34269925-34269947 CAGAAGGAAATGTGGGGAAATGG - Intergenic
1095634050 12:44410341-44410363 CAATAGGAACTGAGGGAAATAGG - Intergenic
1096150374 12:49306434-49306456 CAGAAGGAACTGAGGAGCATAGG - Intergenic
1096332202 12:50723489-50723511 GTGAAGGAACTGGGGGAAAGTGG + Intronic
1097397508 12:59093713-59093735 CTGAAGGAACTGTGGGTAGTGGG + Intergenic
1097801336 12:63917781-63917803 CAGAAAGCAGGGTGGGAAATTGG - Intronic
1099100295 12:78431556-78431578 CAGAATGAACTGATGGAAATGGG - Intergenic
1099291845 12:80784867-80784889 AAGAAGGAAATGTGGGGAAATGG + Intergenic
1100021081 12:90070335-90070357 GAGAAAGAACTGGGGAAAATTGG - Intergenic
1100519396 12:95358716-95358738 CAGAAGGAACTTCTGTAAATGGG - Intergenic
1101488470 12:105190345-105190367 CAGAGAGAACTGCAGGAAATGGG - Intronic
1102291953 12:111708133-111708155 AAGCAGGAACTGTGGGAACAAGG - Intronic
1102727039 12:115074871-115074893 CAGCAGGCCCTCTGGGAAATAGG + Intergenic
1102846973 12:116195314-116195336 TAGAAGGGACTGTGGGGAGTGGG + Intronic
1102909443 12:116701409-116701431 CTGAAGGGACTGGGGGAAATGGG - Intergenic
1103226577 12:119292941-119292963 CAGAAGCTGCAGTGGGAAATGGG - Intergenic
1103252295 12:119510687-119510709 CAGAAGAAAGTGGGGGAAGTAGG - Intronic
1105323194 13:19346685-19346707 CAGAAGGAAATGTGAGCAGTGGG - Intergenic
1105874195 13:24539180-24539202 CAGAAGGAAATGTGAGCAGTGGG + Intergenic
1106039563 13:26076632-26076654 CAGAAGGATGTGTGGGGAGTGGG - Intergenic
1106216274 13:27703705-27703727 TAAAAGGAACTGAGGCAAATAGG + Intergenic
1106234681 13:27851927-27851949 CAGAAGGAACGGTGGGCACTCGG - Intergenic
1107220013 13:37970758-37970780 AAGAAGGAAATGTGGGGAAATGG + Intergenic
1107320042 13:39176890-39176912 GAGAAGGAAGTGTGGAAGATAGG - Intergenic
1109147343 13:58796137-58796159 CAGTAGAAAATATGGGAAATAGG + Intergenic
1109343880 13:61092664-61092686 AAGAAGGAAATGTGGGGAAATGG - Intergenic
1109528683 13:63610233-63610255 CAGAAGAACCTGGGGGAAAGTGG - Intergenic
1110845593 13:80187607-80187629 AAGAAGGAAATGTGGGGAAATGG - Intergenic
1111392948 13:87623203-87623225 AGGAAAGAACTGTGGAAAATGGG - Intergenic
1113278332 13:108760245-108760267 CTTAAGGAGCTGTGAGAAATAGG - Intronic
1113411653 13:110095454-110095476 TAGAAGGAATTTTGGGGAATGGG - Intergenic
1114035013 14:18616044-18616066 CAGTAAGATTTGTGGGAAATGGG + Intergenic
1114123632 14:19698972-19698994 CAGTAAGATTTGTGGGAAATGGG - Intergenic
1115387370 14:32813403-32813425 CCGAAGGACCTCTGGGAAAGGGG - Intronic
1115668629 14:35583005-35583027 TAAAAGGAACTCTGGTAAATAGG - Intronic
1116702112 14:48256954-48256976 AAGAAGGAAATGTGGGGAAATGG + Intergenic
1118410016 14:65469345-65469367 TAAAAGGAACTGAGGTAAATAGG + Intronic
1118594437 14:67424894-67424916 AGGAAGGAACTGAGGGAAACTGG - Intergenic
1118889729 14:69898891-69898913 CAAAAGGACTTGTGGTAAATAGG + Intronic
1118936952 14:70297205-70297227 AAGAAGGAAATGTGGGAAATGGG + Intergenic
1120734133 14:88034571-88034593 TGGTAGGAACTGTGGCAAATAGG - Intergenic
1121528771 14:94638163-94638185 AAGAAGGAGCTGTGGAAAGTGGG - Intergenic
1121703937 14:95977090-95977112 AAGAAGGAAATGTGGGGAAATGG - Intergenic
1122053483 14:99075998-99076020 CAGAAGGGAGAGTGGGAAAAGGG - Intergenic
1122570535 14:102696188-102696210 CTCAAGCTACTGTGGGAAATCGG + Intronic
1123114656 14:105889276-105889298 CAGAAGGCACTGAAAGAAATCGG - Intergenic
1123116817 14:105898677-105898699 CAGAAGGCACTGAAAGAAATCGG - Intergenic
1123118872 14:105907951-105907973 CAGAAGGCACTGAAAGAAATCGG - Intergenic
1123121101 14:105917546-105917568 CAGAAGGCACTGAAAGAAATCGG - Intergenic
1123796561 15:23777909-23777931 CAGTAGGAACTGAGGTAACTAGG + Intergenic
1124624882 15:31302158-31302180 CAGTGGGAACTGTGGGACAGAGG + Intergenic
1124821744 15:33053000-33053022 GAGAAGGGACTGTGGGGAGTGGG - Intronic
1125142299 15:36422609-36422631 GAAAAAGAACTGAGGGAAATGGG + Intergenic
1125602777 15:40924628-40924650 CAGAAGGAAATGAAGGAAAAAGG - Intergenic
1126510291 15:49463710-49463732 CAGAAGGAACTGTGTGAGAAAGG - Intronic
1126649836 15:50909120-50909142 CAGAACTAACTGTGGAAACTCGG - Intronic
1126844055 15:52742880-52742902 AAGAAGGAAATGTGGGGAAATGG - Intergenic
1129073570 15:72972419-72972441 CAGAAACAAGTGTGGGAAGTGGG - Intergenic
1129360405 15:75020690-75020712 GAGAAGGGAAGGTGGGAAATGGG - Exonic
1129968009 15:79754021-79754043 CAGAAGGCACTGTGGGAGACAGG - Intergenic
1131882260 15:96873603-96873625 AAGAAGGAAATGTGGGGAAATGG + Intergenic
1132263302 15:100444429-100444451 AAGAAGGAAATGTGGGGAAATGG - Intronic
1132340677 15:101076469-101076491 AAGAAGGAAATGTGGGGAAATGG - Intronic
1132410411 15:101573722-101573744 AGGAAGGACCTGTGAGAAATGGG + Intergenic
1132966318 16:2657269-2657291 CCTCAGGATCTGTGGGAAATTGG - Intergenic
1133347445 16:5080413-5080435 CAGCAGTAACTGTGGGACAGGGG - Intronic
1133606675 16:7394366-7394388 CAGAAGGGACTGGGTAAAATTGG - Intronic
1133762607 16:8811750-8811772 CACAACAAACTCTGGGAAATGGG - Intronic
1133869294 16:9672871-9672893 AAGAAGGAAATGTGGGGAAATGG + Intronic
1134388394 16:13795425-13795447 CATAAGGAATGATGGGAAATTGG + Intergenic
1134483054 16:14634722-14634744 TAGACGGATCAGTGGGAAATAGG + Intronic
1134778732 16:16876075-16876097 GACTAGGAACTGTGGGAGATGGG + Intergenic
1135003205 16:18794477-18794499 GAAAAGGAACTGTGGGAATATGG - Intronic
1135619378 16:23942222-23942244 CAGAGGGAAGTGTAGGAAACTGG + Intronic
1135734742 16:24921663-24921685 CAGGAGTAACTGTGAGAAAAAGG - Intronic
1137055057 16:35741430-35741452 AAGAAGGAAATATGGGGAATGGG + Intergenic
1137972764 16:53001996-53002018 AAGAAGGAAATGAGGGAAAGGGG + Intergenic
1138592409 16:58009136-58009158 TAAAAGGAACTGTGGTAAACAGG + Intronic
1138790197 16:59894994-59895016 CAAAAGGAACTGAGGTAAATAGG + Intergenic
1139192311 16:64879056-64879078 CAGCAGGAACAGAGGGAAAAAGG - Intergenic
1140322116 16:73962906-73962928 GAGAAGGAACTTTGTGAACTTGG + Intergenic
1140474668 16:75233889-75233911 CAGAAGGAGCTGCTGGAAAAGGG - Exonic
1144182833 17:12768819-12768841 CAGAAAGAAATGTGGGTTATTGG + Exonic
1145997278 17:29111894-29111916 CATATGGAGCTGTGGGAAAGGGG + Intronic
1147725053 17:42561912-42561934 CAGAAGGGAATCTGTGAAATGGG + Intronic
1148221152 17:45863242-45863264 CAGAGGGAACTCTGGCTAATGGG - Intergenic
1149929845 17:60740552-60740574 TAAAAGGAACTATGGTAAATGGG + Intronic
1150721214 17:67615748-67615770 AAGAAGGAACGGGGAGAAATTGG + Intronic
1151502032 17:74496467-74496489 GAGAAAGAGCTCTGGGAAATGGG + Intergenic
1151839494 17:76607742-76607764 AAGAAGGAAATGTGGGGAAATGG + Intergenic
1152360188 17:79829444-79829466 CAGCAGGAACTGAGGGAAGAAGG + Intergenic
1153297781 18:3564160-3564182 TGAAAGGAACTGTGGTAAATTGG + Intronic
1153751673 18:8238710-8238732 TAACAGGAACTGTGGTAAATAGG + Intronic
1154310868 18:13265378-13265400 CCGGAGGAACTGAGTGAAATGGG - Intronic
1155174114 18:23288188-23288210 AAGAAGGAAATGTGGGGAAATGG - Intronic
1155845581 18:30701606-30701628 TACAAGGAAATGTGGAAAATTGG + Intergenic
1157146614 18:45169697-45169719 AAGAAGCCACTGTGGGAAAATGG - Intergenic
1158394393 18:57068414-57068436 AAGAAGGAAATGTGGGGAAATGG + Intergenic
1159273163 18:66180253-66180275 AAGGAGGAACTGGGAGAAATTGG - Intergenic
1160540719 18:79620713-79620735 CAGCAGACACTGTGTGAAATCGG + Intergenic
1161575023 19:5050412-5050434 CAGAAGGGGCTGCGGGAAGTTGG - Intronic
1162271734 19:9621438-9621460 CAGACGGAACTGTGGGCGAGGGG + Intronic
1162404014 19:10462696-10462718 AAGGAGGAATTGGGGGAAATGGG - Intronic
1162446400 19:10725536-10725558 CAGAGGGATCTGTGGGAATATGG + Intronic
1162853635 19:13451202-13451224 CAGAAGGAGCTGTGGCCTATTGG - Intronic
1163154319 19:15431952-15431974 ATGAAGGAACTGTGCCAAATGGG + Intronic
1163381680 19:16973217-16973239 CAAATAGAACTGTGGGAACTAGG + Intronic
1164635203 19:29786491-29786513 AAGAAGGAGCAGTGGGAGATGGG + Intergenic
1165496749 19:36157207-36157229 AAGAAGGAAATGTGGGGAAATGG + Intergenic
1165619760 19:37235813-37235835 GAAAAGGAAGAGTGGGAAATTGG + Intronic
1165835618 19:38753536-38753558 AAGAAGGAAATGTGGGGAAATGG - Intronic
1166699432 19:44873902-44873924 CAGGAGGGTCTGGGGGAAATGGG - Exonic
1168211873 19:54896677-54896699 AAGAAGGAAATGTGGGGAAATGG + Intergenic
1168227731 19:55008582-55008604 AAGAAGGAAATGTGGGGAAATGG + Intergenic
925931799 2:8714173-8714195 CAGAAAGAAACCTGGGAAATGGG - Intergenic
926408015 2:12573679-12573701 AAGAAGGAAATGTGGGGAAATGG - Intergenic
926411232 2:12604784-12604806 CAGATGGAAGTGTGGGAAGAGGG + Intergenic
926611315 2:14951175-14951197 CAGAAGAAAGGATGGGAAATAGG + Intergenic
926660282 2:15458142-15458164 AAGAAGGAAATGAGGGAAAAAGG + Intronic
927439411 2:23101816-23101838 CAATAGGAACTGAGGTAAATGGG + Intergenic
927915457 2:26933230-26933252 CACAAGAAACAGTGGGAAGTAGG - Intronic
928500367 2:31886804-31886826 CAGAAGGTACACTGGGAAAATGG + Intronic
929123047 2:38499165-38499187 CAGTAGGCACTGTGGGGAAGGGG + Intergenic
929422127 2:41803011-41803033 TAAAAGGAACTGAGGCAAATAGG + Intergenic
930381946 2:50641302-50641324 CAGCAGCAAATGAGGGAAATGGG - Intronic
930519485 2:52447097-52447119 CAGAAGTAAATTTGGGAAGTTGG - Intergenic
930692712 2:54380695-54380717 CAGAGGCAAGTGTGGGAACTAGG - Intronic
930898991 2:56480904-56480926 CAGTAGGGAGTGTGGAAAATGGG + Intergenic
930955346 2:57196878-57196900 AAGAAGGAAATATGGGAAATGGG - Intergenic
931114288 2:59147932-59147954 TAAGAGGAACTGTGGCAAATAGG + Intergenic
931404140 2:61960212-61960234 GAGAAGGGATTGTGAGAAATGGG - Intronic
931948540 2:67335741-67335763 AAGAAGGAAATGTGGGGAAATGG - Intergenic
932296113 2:70624642-70624664 AAGAAGGAAATGTGGGGAAATGG - Intronic
932360625 2:71102657-71102679 GAAAAGGAACTCTGGTAAATAGG - Intergenic
932725053 2:74172650-74172672 CAGAAGCAACTCTAGGAAGTGGG - Exonic
933710470 2:85321864-85321886 CAGTAGGAACTTTTTGAAATAGG - Intronic
935769141 2:106400318-106400340 CAGAAGAAAATGAGGTAAATTGG + Intronic
935910953 2:107895599-107895621 CAGAAGAAAATGAGGTAAATTGG - Intergenic
936132737 2:109860637-109860659 CAGAAGAAAATGAGGTAAATTGG - Intergenic
936211960 2:110510848-110510870 CAGAAGAAAATGAGGTAAATTGG + Intergenic
936394577 2:112112545-112112567 CAGCAGGACCTTTGGGAAAGTGG - Intronic
936421100 2:112365409-112365431 CAGAAGAAAATGAGGTAAATTGG + Intergenic
936896682 2:117435571-117435593 CATTAGGAAATGTGGCAAATTGG + Intergenic
936942691 2:117902255-117902277 TAAAAGGAACTGTGGTAGATGGG + Intergenic
937522753 2:122732232-122732254 CAGAAAACACTGTGGGAAAAGGG + Intergenic
938327196 2:130417564-130417586 CAGTAAGATTTGTGGGAAATGGG - Intergenic
938362742 2:130703913-130703935 CAGTAAGATTTGTGGGAAATGGG + Intergenic
939167610 2:138656076-138656098 GAGATGGAACTATGGGAAAGGGG - Intergenic
940157738 2:150677090-150677112 CAGAAGGAATTCTGGGCATTTGG + Intergenic
940906545 2:159174897-159174919 CAGAAGGAGCTGTGTGAAGAGGG + Intronic
941000094 2:160193665-160193687 CAGAAGGAAAGGAGGAAAATAGG - Intronic
941369548 2:164647189-164647211 CAGTAGGAAGTGTGGCAAACTGG - Intergenic
941455884 2:165711905-165711927 AAGAAGGAAATGTGGGGAAATGG + Intergenic
941935605 2:170979207-170979229 AAGAAGGAAATGTGGGGAAATGG + Intergenic
942479970 2:176374897-176374919 AAGAAGGAAATGTGTGAGATGGG - Intergenic
942567986 2:177285474-177285496 CAGAAGGAACTGTGGACATCTGG + Intronic
943687731 2:190836819-190836841 CTGAAGGAAATTTGGGAATTAGG + Intergenic
943806890 2:192134340-192134362 AAGAAGGAAATGTGGGGAAATGG - Intronic
944062446 2:195583617-195583639 CAACAGGAGCTGTGGGAACTTGG + Intronic
944387700 2:199183300-199183322 AAGAAGGAAATGTGGGGAAATGG - Intergenic
945309448 2:208294500-208294522 TAAAAGGAACTATGGTAAATAGG + Intronic
945376357 2:209081999-209082021 AAGAAGGAAATGTGGGGAAATGG - Intergenic
945554952 2:211265368-211265390 AAGAAGGAAATGTGGGGAAATGG - Intergenic
945749074 2:213757693-213757715 CAGGGGTGACTGTGGGAAATGGG - Intronic
947229068 2:227867149-227867171 CAGAACGAAGTGAGTGAAATTGG - Intergenic
947638824 2:231694499-231694521 CAGAAGGAACTGGTGGAGGTGGG - Intergenic
947816506 2:233041069-233041091 CAGAAGGATCTGTGGTATTTTGG - Intergenic
948870700 2:240796482-240796504 CAGGATGCACTGTGGGAGATTGG - Intronic
1170325205 20:15149398-15149420 AAGAAGGAAATGTGGGGAAATGG + Intronic
1170667241 20:18397325-18397347 TAGAAGGAACTTTATGAAATAGG - Intronic
1170750956 20:19144574-19144596 CAGAAAGAAATCTGGAAAATCGG + Intergenic
1170956934 20:20989780-20989802 TAGGAGAAACTGTGGGAAAGGGG + Intergenic
1172533791 20:35654629-35654651 CAGAAGGAACTGGGGGAATCGGG + Exonic
1172932159 20:38594119-38594141 AAGAAGGAAATGTGGGGAAATGG + Intergenic
1173060590 20:39656283-39656305 CAGAAGTACCTGGGAGAAATGGG - Intergenic
1173102161 20:40097256-40097278 AAGAAGGAAATGTGGGGAAATGG - Intergenic
1173361057 20:42344730-42344752 CAGAAGGGAGTGTGGAACATTGG - Intronic
1173837844 20:46137412-46137434 CAGGAGGGACTGTGTGGAATAGG + Intergenic
1174760989 20:53207227-53207249 GAGAAGGAAGAGAGGGAAATTGG + Intronic
1176364483 21:6024446-6024468 CAGAAGGAAGTTGGGGAAACAGG + Intergenic
1176589034 21:8622444-8622466 GAGAAGGAGTTTTGGGAAATAGG - Intergenic
1177030885 21:15981370-15981392 AAGAAGGAAATATGGGAAAATGG + Intergenic
1177100931 21:16896468-16896490 AAGAAGGAAATGTGGGGAAATGG - Intergenic
1177102961 21:16918127-16918149 AAGAAGGAAATGTGGGGAAATGG - Intergenic
1177119825 21:17125417-17125439 AAGAAGGAAATGTGGGGAAATGG - Intergenic
1177282881 21:19007202-19007224 TAAAAGGTACTGTGGTAAATAGG - Intergenic
1177298025 21:19202394-19202416 CAGAATCAGCTGTGGGAAAGAGG - Intergenic
1177501827 21:21966786-21966808 TAGAAGCTACTGTGGAAAATGGG + Intergenic
1177668360 21:24191763-24191785 CATAAGTAACTGTTGAAAATGGG + Intergenic
1178193435 21:30314487-30314509 TAGTAGGAACTGAGGCAAATTGG + Intergenic
1178448390 21:32666883-32666905 TAGAAGTATCTGTGGGAGATTGG + Intronic
1178709544 21:34902839-34902861 CACTTGGAATTGTGGGAAATCGG + Intronic
1179242320 21:39603190-39603212 GAGGAGGAAATTTGGGAAATGGG + Intronic
1179759035 21:43514099-43514121 CAGAAGGAAGTTGGGGAAACAGG - Intergenic
1180271858 22:10599441-10599463 GAGAAGGAGTTTTGGGAAATAGG - Intergenic
1180459133 22:15543090-15543112 CAGTAAGATTTGTGGGAAATGGG + Intergenic
1180743705 22:18072308-18072330 TATAAGGAACTGTGGAAACTTGG + Intergenic
1181953665 22:26572651-26572673 CAGAGGGGACTGTGAGACATAGG - Intronic
1182265578 22:29112358-29112380 GAGAAGGTGCTGTGGGTAATAGG + Intronic
1183901554 22:41009706-41009728 CAGGAGGAAGTGTGGGCAATGGG + Intergenic
1184247779 22:43244469-43244491 CAGAAGCAAGTCTGGGAACTGGG + Intronic
949671415 3:6401605-6401627 AAGAAGGAAATATGGGAAAATGG - Intergenic
950439785 3:13003476-13003498 CACAAGGGACTGAGGGAAAATGG + Intronic
952894913 3:38072072-38072094 AAGAAGGAAATGTGGGGAAATGG + Intronic
953006492 3:38984078-38984100 GAGAAGGAACAGTGGGAAAGAGG - Intergenic
953117183 3:40004626-40004648 CAGAAGGAAAGGTGGGAGTTGGG - Intronic
953183889 3:40620616-40620638 AGGAAGGAACAGTTGGAAATGGG + Intergenic
953834178 3:46328899-46328921 AAGAAGGAAATATGGGAAAATGG + Intergenic
954213955 3:49114085-49114107 CACCAGGAACTGTGGCAAAAAGG + Exonic
954902123 3:54028920-54028942 CTGATGGTACTGTGGGAACTGGG - Intergenic
954969019 3:54636272-54636294 AAGAAGGAAATATGGGAAAATGG + Intronic
955253663 3:57307804-57307826 AAGAAGGAAATATGGGAAAATGG - Intronic
956709507 3:72027127-72027149 AAGAAGGAAATGTGGGGAAATGG - Intergenic
957051828 3:75417589-75417611 CAGCAGTAACTGTGGGACAGGGG - Intergenic
957059637 3:75471646-75471668 AAGAAGGAAATGTGGGGAAATGG + Intergenic
957502222 3:81072046-81072068 TCGAAGAAACTGTGGAAAATAGG - Intergenic
958560463 3:95742616-95742638 CTAAAGGAGCTGTGGGAAAAGGG - Intergenic
959559122 3:107759075-107759097 CAAAAAAAACTGGGGGAAATTGG + Intronic
960193933 3:114741910-114741932 CAGAAGGAAATCAGGGAAAATGG + Intronic
960289668 3:115868199-115868221 CAGAAAGAGCTGTGGGCCATTGG + Intronic
961293764 3:125867733-125867755 AAGAAGGAAATGTGGGGAAATGG - Intergenic
961881301 3:130063193-130063215 AAGAAGGAAATGTGGGGAAATGG - Intergenic
961892305 3:130140452-130140474 AAGAAGGAAATGTGGGGAAATGG + Intergenic
962092915 3:132263806-132263828 TAGGAGAAGCTGTGGGAAATTGG - Intronic
962660922 3:137599616-137599638 AAGAAGGAAATGTGGGGAAATGG - Intergenic
963083130 3:141413079-141413101 GAGGAGGAATTGTGGGAAATGGG + Intronic
963663603 3:148155576-148155598 AAGAAGGAAATGTGGGGAAATGG - Intergenic
964141119 3:153400757-153400779 TAAAAGGAACTGAGGTAAATAGG - Intergenic
964433472 3:156628962-156628984 CAGAAGGAGAAGTGGGTAATAGG - Intergenic
965262369 3:166502352-166502374 AAGAAGGAAATGTGGGGAAATGG + Intergenic
965336614 3:167435357-167435379 AAGAAGGAAATGTGGGGAAATGG - Intergenic
965612317 3:170557345-170557367 CAGAAAGCAAGGTGGGAAATCGG + Intronic
965639727 3:170819367-170819389 AAGAAGGAAATGTGGGGAAATGG + Intronic
966288531 3:178326686-178326708 CTGAAGGAAGGGTGGGAAATAGG - Intergenic
967346897 3:188467342-188467364 CATGAGGAACTCTGGAAAATAGG + Intronic
967871948 3:194236991-194237013 TAAAAGGAACTGTTGTAAATGGG - Intergenic
968994626 4:3937964-3937986 CAGCAGTAACTGTGGGACAGGGG - Intergenic
969003538 4:4001832-4001854 AAGAAGGAAATGTGGGGAAATGG + Intergenic
969165877 4:5311855-5311877 CAGAAGAAACTGTGTAAAACTGG - Intronic
969236915 4:5871855-5871877 CAGAAGAGACCGTAGGAAATGGG + Intronic
969573745 4:8024735-8024757 CAGAAGGAGCTTTGGGATCTTGG + Intronic
969653773 4:8484190-8484212 AAGAAGGAAATGTGGGGAAATGG + Intronic
969750471 4:9106694-9106716 AAGAAGGAAATGTGGGGAAATGG - Intergenic
969759373 4:9170829-9170851 CAGCAGTAACTGTGGGACAGGGG + Intronic
969810386 4:9642991-9643013 TAGAAGGAAATGTGGGGAAATGG - Intergenic
969819322 4:9708260-9708282 CAGCAGTAACTGTGGGACAGGGG + Intergenic
970256168 4:14172306-14172328 AAGAAGGAAATGTGGGGAAATGG + Intergenic
970341463 4:15111559-15111581 CAGAAGCAACTTTGAGACATGGG + Intergenic
970490876 4:16572347-16572369 CAGACGGTAAGGTGGGAAATTGG - Intronic
970532982 4:17001593-17001615 AAGAAGGAAATGTGGGGAAATGG - Intergenic
971136254 4:23871840-23871862 CAGAAAGAACTGTGGAGAAGAGG + Intronic
971821475 4:31561168-31561190 TAAAAGGAACTGTGGTAAGTAGG - Intergenic
973170525 4:47137241-47137263 AAGAAGGAACAGTAGGAAAGAGG + Intronic
973334724 4:48944533-48944555 CAGAAGATAATGTGAGAAATCGG + Intergenic
974100679 4:57412643-57412665 AATGAGGAACTGGGGGAAATTGG - Intergenic
974221909 4:58985926-58985948 CAGAAGATACTGTGGGAGAAGGG + Intergenic
974861443 4:67526601-67526623 TGGAAGGAACTGTGTAAAATTGG - Intronic
975791368 4:77955400-77955422 AAAAAACAACTGTGGGAAATGGG - Intergenic
976104197 4:81599535-81599557 AAGCAGGGACTGAGGGAAATAGG - Intronic
977797612 4:101185922-101185944 CAGCAGTAACTCTGGGAGATAGG - Intronic
978475002 4:109116557-109116579 TAAAAGGAACTGTGGTAAATAGG - Intronic
979249051 4:118544929-118544951 CAGAAGGAAATGTAGAAAGTTGG + Intergenic
979364023 4:119798739-119798761 CAGAGACAAATGTGGGAAATGGG - Intergenic
979850055 4:125563416-125563438 AAGAAGGAAATGTGGGGAAATGG + Intergenic
979894918 4:126146932-126146954 AAGAAGGAAATGTGGGGAAATGG + Intergenic
980400918 4:132284730-132284752 CAGGAGGAAGCGTGTGAAATGGG - Intergenic
980611528 4:135169087-135169109 AAGAAGGAAATGTGGGGAAATGG + Intergenic
982396478 4:154920637-154920659 AAGAAGGAAATGTGGGGAAATGG + Intergenic
982421201 4:155200363-155200385 CTGAAGAAGCTGTGGAAAATAGG + Intergenic
982495013 4:156079940-156079962 CAGAAGGAAATTTGGGCATTTGG - Intergenic
982496869 4:156105267-156105289 AAGAAGGAAATGTGGGGAAATGG + Intergenic
983448307 4:167880249-167880271 AAGAAGGAAATGTGGGGAAGTGG - Intergenic
984322434 4:178211016-178211038 AAGAAGGAAATGTGGGGAAACGG - Intergenic
985238761 4:187906220-187906242 TAGAAGGAACTGTGGTAGATAGG - Intergenic
985435989 4:189929992-189930014 AAGAAGGAAATGTGGGGAAATGG - Intergenic
986404285 5:7410182-7410204 CAGCAGGAAGTGATGGAAATTGG + Intronic
986465695 5:8020813-8020835 TAAAAGGAACTGTGGCAAATAGG + Intergenic
986501956 5:8410080-8410102 CAGAAAGAACTGGTGGGAATAGG + Intergenic
986940967 5:12948664-12948686 TAAAAGGAACTCTGGTAAATAGG - Intergenic
986964470 5:13253867-13253889 CAGAAGGAATTATGGGGAGTGGG - Intergenic
988536421 5:32073087-32073109 CAGAAAGAAGTCTGAGAAATCGG - Intronic
988585688 5:32505629-32505651 AAGAAGGAACAGTGGCAGATGGG + Intergenic
989166769 5:38440157-38440179 CAGAGGGAACTGCAGGACATTGG + Intronic
989669024 5:43892093-43892115 CAAGAGGAACTGTAGGAAGTGGG + Intergenic
989688618 5:44116139-44116161 AAGAAGGAAATATGGGAAAATGG + Intergenic
990202049 5:53386595-53386617 TAAAAGGAACTGGGGTAAATAGG - Intergenic
993466420 5:88252268-88252290 AAAAAGGAACTGTGGAAAATAGG + Intronic
993608788 5:90029160-90029182 CAGAGGGAAGTGTGGGAGGTGGG + Intergenic
994163898 5:96587585-96587607 CAGAAAGACCAGTAGGAAATGGG + Intronic
994532301 5:100986042-100986064 AAGAAGGAAATGTGGGGAAATGG + Intergenic
994561981 5:101386107-101386129 CAGAAGAGGCTGTGGGAAAATGG + Intergenic
994737549 5:103573854-103573876 CAGAAGGAAATCTGGAAATTTGG + Intergenic
994774974 5:104029194-104029216 ATGAAGTAACTGAGGGAAATTGG + Intergenic
994778705 5:104065982-104066004 AAGAAGGAAATGTGGGGAAATGG + Intergenic
995296921 5:110533760-110533782 AAGAAGGAAATGTGGGGAAATGG - Intronic
995899121 5:117048160-117048182 AAGAAGGAAATGTGGGGAAATGG + Intergenic
996129571 5:119765418-119765440 CAGAAGGAAGTATGGGAAGGAGG - Intergenic
996433407 5:123405744-123405766 CAAAAGGAACTGCTGTAAATAGG - Intronic
997678551 5:135733307-135733329 AAGAAGGAAATGTGGGGAAATGG + Intergenic
998548305 5:143050983-143051005 CAGAAGGGACTGTTAGAGATAGG + Intronic
998563938 5:143199398-143199420 CAAAAGGAACAGTGGTAAATTGG - Intronic
998714467 5:144867326-144867348 AAGAAGGAACAGTGGGAGGTAGG - Intergenic
1000786027 5:165544778-165544800 CAAAAGGATCGATGGGAAATAGG - Intergenic
1001038863 5:168317588-168317610 CAGGAGGCAATGGGGGAAATAGG - Intronic
1001144059 5:169168813-169168835 CAGGAGGAACAAGGGGAAATGGG + Intronic
1001331200 5:170763830-170763852 AAGAAGGAAATGTGGGGAAATGG + Intronic
1002696318 5:181093546-181093568 TAAAAGGAACTCTGGTAAATAGG - Intergenic
1003619052 6:7681228-7681250 CATAAGGCAGTGTTGGAAATGGG + Intergenic
1004285985 6:14321404-14321426 CAGGAGGAAAGGGGGGAAATTGG - Intergenic
1004768321 6:18755855-18755877 AAGAAGGAAATGTGGGGAAATGG + Intergenic
1004837288 6:19543042-19543064 AAGAAGGAAATGTGGGGAAATGG - Intergenic
1005014402 6:21363291-21363313 AAGAAGGAAATGTGGGGAAATGG + Intergenic
1006339046 6:33435987-33436009 CAGAGGGAACTGGTGGCAATGGG + Intronic
1007160937 6:39791489-39791511 CAGAGGGAGCTGGGGAAAATAGG + Intergenic
1007919100 6:45589953-45589975 CACAAGGAGGTGTGGGAAGTGGG - Intronic
1008137163 6:47790152-47790174 CAGAAGGAAATGTGGAAATCTGG + Intronic
1008155545 6:48009401-48009423 CAAAAGGAAATGTTGGGAATCGG - Intronic
1010287928 6:74100977-74100999 CACAAGGCACTGTGAGAGATGGG + Intergenic
1011079801 6:83477075-83477097 CATATGGAACTGTGAGAAAATGG + Intergenic
1011106821 6:83791224-83791246 CTGGAGAAACTGTTGGAAATGGG + Intergenic
1011656791 6:89559424-89559446 CATAAGGAACTGTGGAAACTGGG - Intronic
1012675343 6:102105881-102105903 AAGAAGGAAATGTGGGGAAAGGG - Intergenic
1013891958 6:115035806-115035828 AAGAAGGAAATGTGGGGAAATGG - Intergenic
1014309398 6:119781618-119781640 CAGAAGGAACTGTGCAACACTGG + Intergenic
1015141889 6:129943929-129943951 GACCAGGAACTGTGGGAACTAGG + Intergenic
1015165487 6:130196453-130196475 AAGAAGGAAATGTGGGGAAATGG - Intronic
1016204809 6:141456952-141456974 AAGAAGGAAATGTGGGGAAATGG - Intergenic
1016519054 6:144927096-144927118 AAGAAGGAAATGTGGGGAAATGG - Intergenic
1016577894 6:145590771-145590793 TAAAAGGAACTGTGGTAAATGGG - Intronic
1016650041 6:146452208-146452230 AAGAAGGAAATGTGGGGAAATGG + Intergenic
1017558354 6:155599213-155599235 CAAAATGTACAGTGGGAAATGGG + Intergenic
1017621763 6:156306680-156306702 CAGAAGGAAGTGTGGGTAGGAGG - Intergenic
1018521217 6:164653942-164653964 AAGAAGGAAATGTGGGGAAATGG + Intergenic
1020316302 7:6907705-6907727 AAGAAGGAAATGTGGGGAAATGG - Intergenic
1020322512 7:6949944-6949966 AAGAAGGAAATGTGGGGAAATGG + Intergenic
1020540852 7:9460121-9460143 AAGAAGGAAATGTGGGGAAATGG + Intergenic
1021491529 7:21224497-21224519 CAAAAGGAAATGTGGAAATTGGG + Intergenic
1021810900 7:24400198-24400220 AAGAAGGAAATGTGGGGAAATGG - Intergenic
1022227342 7:28376809-28376831 CAGAAGAAGCTGGGGCAAATTGG + Intronic
1022572510 7:31468606-31468628 AAGAAGGAAATGTGGGGAAATGG + Intergenic
1022709356 7:32836500-32836522 AAGAAGGAAATGTGGGGAAATGG - Intergenic
1023425674 7:40033489-40033511 TAGAAGGAACTGAGGTAAATAGG + Intronic
1023698639 7:42872397-42872419 AAGAAGGAAATGTGGGGAAATGG + Intergenic
1024302406 7:47897235-47897257 CAGATGGAACTGTGCTCAATAGG + Intronic
1024445448 7:49473119-49473141 CAAAATGATCAGTGGGAAATAGG - Intergenic
1024475167 7:49801670-49801692 CAGAATGACCTGGAGGAAATTGG + Intronic
1024475806 7:49808721-49808743 CAGAAGGAAATCTGGGAAATTGG + Intronic
1027684329 7:81264018-81264040 CAAAAGGAAGTGAGGTAAATAGG + Intergenic
1030700458 7:112632930-112632952 CAGAAGGCGCTGTGGGTAGTGGG - Intergenic
1031113208 7:117637290-117637312 TAAAAGGAACTGTAGTAAATAGG + Intronic
1031225725 7:119035638-119035660 CAGCAGGGAATGTAGGAAATAGG - Intergenic
1031874106 7:127118991-127119013 CAGAAGGAACAGTAGCAATTGGG - Intronic
1032508675 7:132454946-132454968 CTGAAGGAGCTGTGGGAAGGTGG - Intronic
1032739287 7:134722801-134722823 CAGCAGGGACTGTGGGTAAATGG - Intergenic
1032766501 7:134999170-134999192 CAGAAGATACTGTGGCAATTTGG - Intronic
1032931517 7:136677891-136677913 CTGAAGCAACTGTGGGGATTGGG - Intergenic
1033211747 7:139465022-139465044 AAGAAGGAAATATGGGGAATTGG - Intronic
1035452848 7:158989614-158989636 CACAAAGAACAGTGGGAAATAGG + Intergenic
1035471455 7:159112536-159112558 CAGAAGCAACTGTGTTAAATAGG + Intronic
1035831228 8:2696838-2696860 CAGAACTGTCTGTGGGAAATGGG - Intergenic
1035853851 8:2951267-2951289 CTGAAGGAACTGTGGGAAGGGGG + Exonic
1035891746 8:3352249-3352271 ATGAAGGAACTATGGGAGATGGG + Intronic
1036198171 8:6741138-6741160 CTAAAGGAGCTGTGTGAAATAGG + Intronic
1036373532 8:8181026-8181048 AAGAAGGAAATGTGGGGAAATGG - Intergenic
1036381517 8:8238860-8238882 CAGCAGTAACTGTGGGACAGGGG + Intergenic
1037079301 8:14763913-14763935 GAGAAGGAACTGTGTGATGTTGG + Intronic
1038101795 8:24386458-24386480 CAGAAGTTTCTGGGGGAAATGGG + Intronic
1038539868 8:28383578-28383600 GAAAAGCAACTGTGGGCAATTGG - Intronic
1038904667 8:31886369-31886391 AAAAAGTAACTGTGTGAAATTGG - Intronic
1040807926 8:51415205-51415227 CAGTAGGAATTGTAGAAAATTGG + Intronic
1043204224 8:77416012-77416034 CAGAAGGAAAAGTGTGAAACTGG + Intergenic
1043250986 8:78072683-78072705 AAGAAGGAAAGGTGGGAAAAGGG - Intergenic
1043837977 8:85066854-85066876 AAGAAGGAAATGTGGGGAAATGG - Intergenic
1044191433 8:89323172-89323194 CAGAAAGAACATTGGGAACTGGG + Intergenic
1044822165 8:96161707-96161729 CAGAAGGAACTTGGGGAAGGAGG - Intergenic
1045402315 8:101831636-101831658 CACAAGGAACTGTGGGTACATGG - Intronic
1046903179 8:119544447-119544469 AAGAAGGAAATAGGGGAAATAGG - Intergenic
1046958266 8:120083666-120083688 CTGAAGGGACTGTGGGAAGAAGG - Intronic
1047005827 8:120619562-120619584 CAGAATGCACTGTGTGAAATGGG - Intronic
1047123245 8:121930153-121930175 CAGAAGGACCTCTTGGAGATTGG - Intergenic
1047946132 8:129882704-129882726 CAGAACGAGCTGTAGGAAAATGG - Intronic
1048135738 8:131744853-131744875 AAGAAGGAAATGTGGGGAAGTGG - Intergenic
1048552270 8:135444589-135444611 TAGAAGGAAATGATGGAAATGGG + Intergenic
1048585178 8:135768937-135768959 AAGAAGGAAATGTGGGGAAATGG + Intergenic
1048763959 8:137826393-137826415 AAGAAGGAAATGTGGGGAAATGG + Intergenic
1050042637 9:1512089-1512111 AAGAAGGAATTCGGGGAAATGGG + Intergenic
1050313134 9:4373323-4373345 CAGAATCACCTGGGGGAAATTGG + Intergenic
1051048086 9:12899636-12899658 TAAAAGGAATTGTGGTAAATAGG + Intergenic
1051881158 9:21841069-21841091 CTGCAGACACTGTGGGAAATTGG - Intronic
1052540376 9:29804087-29804109 GAGGAAGGACTGTGGGAAATTGG - Intergenic
1052653595 9:31330332-31330354 AAGAAGGAAATGTGGGGAAATGG - Intergenic
1054807196 9:69406324-69406346 AAGAAGGAAATGTGGGGAAATGG + Intergenic
1057078443 9:92154006-92154028 CAGAAGGTCCAGTGGGAAAGAGG - Intergenic
1057858404 9:98620630-98620652 AAGAAGGAACTCTGGGAATTAGG + Intronic
1058612676 9:106792482-106792504 AAGAAGGAAATGTGGGGAAATGG - Intergenic
1059381166 9:113927223-113927245 TAAAAGGAACTGAGGTAAATAGG + Intronic
1059783272 9:117552478-117552500 CAGAAGCAACTGTTGGAAACAGG + Intergenic
1060318221 9:122532423-122532445 AAGAAGGAAATGTGGGGAAATGG + Intergenic
1060461306 9:123857141-123857163 CAAAAGGAACCTTGGGAAAATGG + Intronic
1060614719 9:125002393-125002415 CTGAAAGAACTGTGAGAAATAGG - Intronic
1186683433 X:11899980-11900002 CAGAAGGGGCTGTGGAAAAAAGG - Intergenic
1188096203 X:26026366-26026388 CAGAAGGCACTGCCGGAAACTGG + Intergenic
1188156833 X:26750876-26750898 CAAAAGGAACTGAGGTAAATGGG - Intergenic
1188207948 X:27381895-27381917 TAGAAGGAACTGAGGTACATAGG - Intergenic
1189750185 X:44212683-44212705 TAAAAGGAACTGTGGCAAGTAGG - Intronic
1191247378 X:58238575-58238597 CAGAGGCACCTGTGGGAACTTGG + Intergenic
1191761592 X:64653203-64653225 AAGAAGGAAATGTGGGGAAATGG - Intergenic
1193186322 X:78517445-78517467 CAGAAGGAACTGGGTGAAACAGG - Intergenic
1194869650 X:99113388-99113410 TAGAAGGAAGTGAGGGAAAAAGG - Intergenic
1195973554 X:110500250-110500272 AAAAAGGCACTGTGGGAAACTGG - Intergenic
1196220733 X:113110503-113110525 AAGAAGGAAATGTGGGGAAATGG + Intergenic
1196736018 X:118981691-118981713 CAGAAGGAGCTGGGGGAATGCGG + Intronic
1196917248 X:120549956-120549978 CAGAAGGAAATGGGATAAATAGG - Intronic
1198198478 X:134389438-134389460 CAGTAGGGACTGTGGTAAATTGG + Intronic
1199587306 X:149429413-149429435 TATAATGAACTGTGGGGAATTGG + Intergenic
1199619007 X:149682697-149682719 CAAAAGGATTTGGGGGAAATGGG + Intergenic
1200813121 Y:7504871-7504893 AAGAAGGAAATGTGGGGAAATGG - Intergenic
1200870009 Y:8087807-8087829 CAGAAGGAAATGTGACATATTGG - Intergenic
1201581618 Y:15516303-15516325 AAGAAGGAAATGTGGGGAAATGG - Intergenic
1201937423 Y:19423271-19423293 AAGAAGGAAATGTGGGGAAATGG - Intergenic