ID: 1074777415

View in Genome Browser
Species Human (GRCh38)
Location 10:116776194-116776216
Sequence GACACCTGCCTGTGTCCCAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1074777415_1074777420 5 Left 1074777415 10:116776194-116776216 CCTGTGGGACACAGGCAGGTGTC No data
Right 1074777420 10:116776222-116776244 TGGACAACAAGGAGCATCTCAGG No data
1074777415_1074777421 18 Left 1074777415 10:116776194-116776216 CCTGTGGGACACAGGCAGGTGTC No data
Right 1074777421 10:116776235-116776257 GCATCTCAGGTCCGTCCGCCTGG No data
1074777415_1074777419 -6 Left 1074777415 10:116776194-116776216 CCTGTGGGACACAGGCAGGTGTC No data
Right 1074777419 10:116776211-116776233 GGTGTCATGGGTGGACAACAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1074777415 Original CRISPR GACACCTGCCTGTGTCCCAC AGG (reversed) Intergenic
No off target data available for this crispr