ID: 1074777419

View in Genome Browser
Species Human (GRCh38)
Location 10:116776211-116776233
Sequence GGTGTCATGGGTGGACAACA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1074777407_1074777419 9 Left 1074777407 10:116776179-116776201 CCCACCCCTGGGACTCCTGTGGG No data
Right 1074777419 10:116776211-116776233 GGTGTCATGGGTGGACAACAAGG No data
1074777410_1074777419 5 Left 1074777410 10:116776183-116776205 CCCCTGGGACTCCTGTGGGACAC No data
Right 1074777419 10:116776211-116776233 GGTGTCATGGGTGGACAACAAGG No data
1074777409_1074777419 8 Left 1074777409 10:116776180-116776202 CCACCCCTGGGACTCCTGTGGGA No data
Right 1074777419 10:116776211-116776233 GGTGTCATGGGTGGACAACAAGG No data
1074777412_1074777419 3 Left 1074777412 10:116776185-116776207 CCTGGGACTCCTGTGGGACACAG No data
Right 1074777419 10:116776211-116776233 GGTGTCATGGGTGGACAACAAGG No data
1074777402_1074777419 26 Left 1074777402 10:116776162-116776184 CCTCAGCACCTCTGTGGCCCACC No data
Right 1074777419 10:116776211-116776233 GGTGTCATGGGTGGACAACAAGG No data
1074777415_1074777419 -6 Left 1074777415 10:116776194-116776216 CCTGTGGGACACAGGCAGGTGTC No data
Right 1074777419 10:116776211-116776233 GGTGTCATGGGTGGACAACAAGG No data
1074777411_1074777419 4 Left 1074777411 10:116776184-116776206 CCCTGGGACTCCTGTGGGACACA No data
Right 1074777419 10:116776211-116776233 GGTGTCATGGGTGGACAACAAGG No data
1074777405_1074777419 18 Left 1074777405 10:116776170-116776192 CCTCTGTGGCCCACCCCTGGGAC No data
Right 1074777419 10:116776211-116776233 GGTGTCATGGGTGGACAACAAGG No data
1074777401_1074777419 30 Left 1074777401 10:116776158-116776180 CCTGCCTCAGCACCTCTGTGGCC No data
Right 1074777419 10:116776211-116776233 GGTGTCATGGGTGGACAACAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1074777419 Original CRISPR GGTGTCATGGGTGGACAACA AGG Intergenic
No off target data available for this crispr