ID: 1074777421

View in Genome Browser
Species Human (GRCh38)
Location 10:116776235-116776257
Sequence GCATCTCAGGTCCGTCCGCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1074777410_1074777421 29 Left 1074777410 10:116776183-116776205 CCCCTGGGACTCCTGTGGGACAC No data
Right 1074777421 10:116776235-116776257 GCATCTCAGGTCCGTCCGCCTGG No data
1074777412_1074777421 27 Left 1074777412 10:116776185-116776207 CCTGGGACTCCTGTGGGACACAG No data
Right 1074777421 10:116776235-116776257 GCATCTCAGGTCCGTCCGCCTGG No data
1074777415_1074777421 18 Left 1074777415 10:116776194-116776216 CCTGTGGGACACAGGCAGGTGTC No data
Right 1074777421 10:116776235-116776257 GCATCTCAGGTCCGTCCGCCTGG No data
1074777411_1074777421 28 Left 1074777411 10:116776184-116776206 CCCTGGGACTCCTGTGGGACACA No data
Right 1074777421 10:116776235-116776257 GCATCTCAGGTCCGTCCGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1074777421 Original CRISPR GCATCTCAGGTCCGTCCGCC TGG Intergenic
No off target data available for this crispr