ID: 1074777684

View in Genome Browser
Species Human (GRCh38)
Location 10:116778335-116778357
Sequence AGCACCAGCTGGAGGTTTTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1074777684_1074777689 3 Left 1074777684 10:116778335-116778357 CCCCAAAACCTCCAGCTGGTGCT No data
Right 1074777689 10:116778361-116778383 ACAGCCGACCTTACACAGAAAGG No data
1074777684_1074777692 13 Left 1074777684 10:116778335-116778357 CCCCAAAACCTCCAGCTGGTGCT No data
Right 1074777692 10:116778371-116778393 TTACACAGAAAGGTCAGAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1074777684 Original CRISPR AGCACCAGCTGGAGGTTTTG GGG (reversed) Intergenic
No off target data available for this crispr