ID: 1074781079

View in Genome Browser
Species Human (GRCh38)
Location 10:116802789-116802811
Sequence GCCAAGCCCAACAGTGGGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1074781079_1074781087 11 Left 1074781079 10:116802789-116802811 CCCTGCCCACTGTTGGGCTTGGC No data
Right 1074781087 10:116802823-116802845 CCACAGAACATGAGCAGATGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1074781079 Original CRISPR GCCAAGCCCAACAGTGGGCA GGG (reversed) Intergenic
No off target data available for this crispr