ID: 1074782132

View in Genome Browser
Species Human (GRCh38)
Location 10:116809655-116809677
Sequence CTCCTGGGATTCAGGAAAAT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1074782126_1074782132 8 Left 1074782126 10:116809624-116809646 CCGGGGACTGTCTGCGGGGGAAA No data
Right 1074782132 10:116809655-116809677 CTCCTGGGATTCAGGAAAATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1074782132 Original CRISPR CTCCTGGGATTCAGGAAAAT TGG Intergenic
No off target data available for this crispr