ID: 1074782132 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 10:116809655-116809677 |
Sequence | CTCCTGGGATTCAGGAAAAT TGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | No data | |||
Summary | No data |
Found 1 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1074782126_1074782132 | 8 | Left | 1074782126 | 10:116809624-116809646 | CCGGGGACTGTCTGCGGGGGAAA | No data | ||
Right | 1074782132 | 10:116809655-116809677 | CTCCTGGGATTCAGGAAAATTGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1074782132 | Original CRISPR | CTCCTGGGATTCAGGAAAAT TGG | Intergenic | ||
No off target data available for this crispr |