ID: 1074784350

View in Genome Browser
Species Human (GRCh38)
Location 10:116825988-116826010
Sequence ATCTGTAGGTGGCTTCTCCC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1074784350_1074784357 4 Left 1074784350 10:116825988-116826010 CCGGGGAGAAGCCACCTACAGAT No data
Right 1074784357 10:116826015-116826037 GAAGGGCTGTCACATGGAAAGGG No data
1074784350_1074784355 -2 Left 1074784350 10:116825988-116826010 CCGGGGAGAAGCCACCTACAGAT No data
Right 1074784355 10:116826009-116826031 ATGTGTGAAGGGCTGTCACATGG No data
1074784350_1074784358 23 Left 1074784350 10:116825988-116826010 CCGGGGAGAAGCCACCTACAGAT No data
Right 1074784358 10:116826034-116826056 AGGGAATTCCATTCTCTGTGTGG No data
1074784350_1074784356 3 Left 1074784350 10:116825988-116826010 CCGGGGAGAAGCCACCTACAGAT No data
Right 1074784356 10:116826014-116826036 TGAAGGGCTGTCACATGGAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1074784350 Original CRISPR ATCTGTAGGTGGCTTCTCCC CGG (reversed) Intergenic
No off target data available for this crispr