ID: 1074784355

View in Genome Browser
Species Human (GRCh38)
Location 10:116826009-116826031
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1074784350_1074784355 -2 Left 1074784350 10:116825988-116826010 CCGGGGAGAAGCCACCTACAGAT No data
Right 1074784355 10:116826009-116826031 ATGTGTGAAGGGCTGTCACATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1074784355 Original CRISPR ATGTGTGAAGGGCTGTCACA TGG Intergenic