ID: 1074784356

View in Genome Browser
Species Human (GRCh38)
Location 10:116826014-116826036
Sequence TGAAGGGCTGTCACATGGAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1074784353_1074784356 -8 Left 1074784353 10:116825999-116826021 CCACCTACAGATGTGTGAAGGGC No data
Right 1074784356 10:116826014-116826036 TGAAGGGCTGTCACATGGAAAGG No data
1074784350_1074784356 3 Left 1074784350 10:116825988-116826010 CCGGGGAGAAGCCACCTACAGAT No data
Right 1074784356 10:116826014-116826036 TGAAGGGCTGTCACATGGAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1074784356 Original CRISPR TGAAGGGCTGTCACATGGAA AGG Intergenic