ID: 1074784358

View in Genome Browser
Species Human (GRCh38)
Location 10:116826034-116826056
Sequence AGGGAATTCCATTCTCTGTG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1074784353_1074784358 12 Left 1074784353 10:116825999-116826021 CCACCTACAGATGTGTGAAGGGC No data
Right 1074784358 10:116826034-116826056 AGGGAATTCCATTCTCTGTGTGG No data
1074784354_1074784358 9 Left 1074784354 10:116826002-116826024 CCTACAGATGTGTGAAGGGCTGT No data
Right 1074784358 10:116826034-116826056 AGGGAATTCCATTCTCTGTGTGG No data
1074784350_1074784358 23 Left 1074784350 10:116825988-116826010 CCGGGGAGAAGCCACCTACAGAT No data
Right 1074784358 10:116826034-116826056 AGGGAATTCCATTCTCTGTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1074784358 Original CRISPR AGGGAATTCCATTCTCTGTG TGG Intergenic