ID: 1074785929

View in Genome Browser
Species Human (GRCh38)
Location 10:116839956-116839978
Sequence AATTCACTAGGGGCATGCCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1074785929_1074785937 11 Left 1074785929 10:116839956-116839978 CCAAGGCATGCCCCTAGTGAATT No data
Right 1074785937 10:116839990-116840012 CAAGACAGCATACATACGGACGG No data
1074785929_1074785938 12 Left 1074785929 10:116839956-116839978 CCAAGGCATGCCCCTAGTGAATT No data
Right 1074785938 10:116839991-116840013 AAGACAGCATACATACGGACGGG No data
1074785929_1074785936 7 Left 1074785929 10:116839956-116839978 CCAAGGCATGCCCCTAGTGAATT No data
Right 1074785936 10:116839986-116840008 AACTCAAGACAGCATACATACGG No data
1074785929_1074785939 21 Left 1074785929 10:116839956-116839978 CCAAGGCATGCCCCTAGTGAATT No data
Right 1074785939 10:116840000-116840022 TACATACGGACGGGAAAGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1074785929 Original CRISPR AATTCACTAGGGGCATGCCT TGG (reversed) Intergenic
No off target data available for this crispr