ID: 1074789186

View in Genome Browser
Species Human (GRCh38)
Location 10:116869103-116869125
Sequence CCTTTGGGGGACCAGATGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 291
Summary {0: 1, 1: 0, 2: 2, 3: 20, 4: 268}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1074789186_1074789193 11 Left 1074789186 10:116869103-116869125 CCTTCCATCTGGTCCCCCAAAGG 0: 1
1: 0
2: 2
3: 20
4: 268
Right 1074789193 10:116869137-116869159 CATTTCTGACGAACCATTGCAGG No data
1074789186_1074789195 29 Left 1074789186 10:116869103-116869125 CCTTCCATCTGGTCCCCCAAAGG 0: 1
1: 0
2: 2
3: 20
4: 268
Right 1074789195 10:116869155-116869177 GCAGGAACTCCGATTTTGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1074789186 Original CRISPR CCTTTGGGGGACCAGATGGA AGG (reversed) Intronic
900029512 1:360738-360760 CCTTTGGAGGCCCAGGTGGGAGG - Intergenic
900050113 1:589509-589531 CCTTTGGAGGCCCAGGTGGGAGG - Intergenic
900982905 1:6056720-6056742 CCTTTGGGGATACAGAAGGAAGG - Intronic
904564240 1:31418224-31418246 CCATTGGTGGACGAGATGAATGG - Intronic
905243308 1:36595467-36595489 TCTTTATGGGACAAGATGGATGG - Intergenic
906173630 1:43749491-43749513 CTTTTGGGAGACCAGGTGGGAGG + Intronic
906865300 1:49411801-49411823 CATTTGGGGGACTATATGGAAGG + Intronic
909497570 1:76295931-76295953 GCTTTTGGGAAACAGATGGAGGG + Intronic
910782257 1:90951886-90951908 CCTTTGGGGAACCAAATAAAAGG + Intronic
911007361 1:93241196-93241218 CCTTGGGAGGCCCAGGTGGATGG - Intronic
911242209 1:95478957-95478979 CCTTTGGGGGACTACTGGGAAGG + Intergenic
911983420 1:104594302-104594324 CCTTTCTGGGACCTGAAGGATGG - Intergenic
915741692 1:158123527-158123549 ACTTTGGGGGACAAGGTGGGTGG + Intergenic
916033757 1:160902613-160902635 ACTTTGGGGGACCAAGTGGGAGG - Intergenic
917979689 1:180261145-180261167 GCTTTGGGGGCCAAGATGGGAGG + Intronic
919972000 1:202587015-202587037 CCTTTGGGGGATTAGAAGGGAGG - Exonic
920076388 1:203340362-203340384 TCTCTTGGGGACCATATGGAAGG + Intergenic
920811257 1:209287965-209287987 CCTTTGGGGGCCAAGAGGAAAGG + Intergenic
921594236 1:217037658-217037680 ACTTTGGGGGACCATTGGGATGG - Intronic
922466087 1:225846198-225846220 CCTTGGAGGGAGCAGACGGAGGG + Exonic
922826919 1:228528115-228528137 GCTTTGAGGGCCCTGATGGATGG + Intergenic
1063262580 10:4406927-4406949 ACTTTGGGAGGCCAGGTGGATGG + Intergenic
1067522139 10:47015982-47016004 CCCTTGGGGGACCAAAGAGAAGG + Intergenic
1069751622 10:70748804-70748826 CCTTGGGGTGTCCAGGTGGAAGG - Intronic
1069800525 10:71078910-71078932 GCTTTGGGTGACCAGATGGATGG - Intergenic
1070046830 10:72846771-72846793 CCCTTTAGGGTCCAGATGGAGGG + Intronic
1070361792 10:75697608-75697630 TCTATGGGAGACCAGGTGGAGGG + Intronic
1072491844 10:95914523-95914545 CAATGGGGGGACCAGATGGAGGG + Intronic
1073057639 10:100712599-100712621 CCTCTGGGGGGCCTGGTGGAGGG - Intergenic
1074723766 10:116286522-116286544 CTTTGGGAGGCCCAGATGGAAGG - Intergenic
1074789186 10:116869103-116869125 CCTTTGGGGGACCAGATGGAAGG - Intronic
1075481056 10:122782170-122782192 CCTTGGTGGGATCAGCTGGAAGG + Intergenic
1075876361 10:125809312-125809334 CCTTTGGGCAGCCAAATGGAAGG + Intronic
1076939135 10:133590271-133590293 CCTTTGGGTGACCAGGAGGCAGG - Intergenic
1077465832 11:2733249-2733271 CCTTTGTGTGTCCAGAGGGAAGG + Intronic
1078604766 11:12765292-12765314 CCTTTTGGGAAGCAGATGGCAGG + Intronic
1080429805 11:32187888-32187910 CTTTTGGAGGCCAAGATGGATGG - Intergenic
1080449638 11:32368297-32368319 ACTTTGGGGGACCATCAGGAAGG - Intergenic
1081120771 11:39262882-39262904 ACTTTGGGGGACCACTGGGAAGG - Intergenic
1081144758 11:39548923-39548945 ACTTTGGGGAACCAGGAGGAAGG + Intergenic
1081407712 11:42716833-42716855 CCTAGGAGGGACCAGGTGGAAGG + Intergenic
1083600480 11:63944409-63944431 CCTTCTGGGGACCAGCTGGGTGG + Intronic
1089578163 11:119461370-119461392 CCTTTGGGAGACCTCATGGTAGG + Intergenic
1091519492 12:1222456-1222478 CTTTGGGGGGACAAGATGGGTGG - Intronic
1091741179 12:2961065-2961087 CCTTTGGGGGATGGGATGGGCGG + Intronic
1091759155 12:3076223-3076245 CTTTGGGGGGCCCAGGTGGAAGG - Intergenic
1092511328 12:9159955-9159977 CCTTTGGGGAACGATATGGCAGG - Exonic
1094289085 12:28825978-28826000 CCTCTGGGGTCCTAGATGGAAGG - Intergenic
1095292652 12:40493214-40493236 TCTTTGGGACACCAGGTGGAAGG - Intronic
1095666987 12:44814140-44814162 CCTCAGGAGGAGCAGATGGAGGG + Intronic
1095711708 12:45295802-45295824 ACTTTGGGAGGCCAGGTGGACGG - Intronic
1095787921 12:46131220-46131242 ACTTTGGGGGAGAAGAGGGAAGG - Intergenic
1097954851 12:65473556-65473578 CCTTTGGGAGGCAAGATGGGAGG - Intronic
1097966097 12:65582997-65583019 ACTTTGGGAGACCAGGTGGGTGG + Intergenic
1098650597 12:72962303-72962325 ACTTTGGGGGTCGAGGTGGACGG + Intergenic
1101105762 12:101438295-101438317 CCTTTGGAGGGCCAGATGCGAGG + Intergenic
1103979226 12:124725631-124725653 CCTCTGGGGCACCAGATGCCAGG + Intergenic
1104326928 12:127808012-127808034 CCTTGCGAGGAGCAGATGGAAGG - Intergenic
1105806042 13:23952078-23952100 CCTTCGGAGGAGCGGATGGAAGG - Intergenic
1107780842 13:43900825-43900847 CTTTGGGAGGACGAGATGGACGG + Intergenic
1107850113 13:44562860-44562882 ACTTTGGGGGCCCAGGTGGGTGG + Intronic
1108890743 13:55255377-55255399 GCTTTGTAGGACCAGATGGTAGG - Intergenic
1110468087 13:75826283-75826305 CTTTTGGAGGCCAAGATGGATGG - Intronic
1110882020 13:80583720-80583742 ACTTTGGGGGAAGAGTTGGAGGG + Intergenic
1111457813 13:88507162-88507184 ACTTTGGGGGACCATTGGGAAGG + Intergenic
1111683683 13:91475673-91475695 CATTTTGGGGCCCAGATGAAGGG + Intronic
1112464649 13:99632994-99633016 ACTTTGGGGGCCCAGGTGGGTGG + Intronic
1112748080 13:102550711-102550733 CCTCTGGGGGACATGAGGGACGG + Intergenic
1116862306 14:50004292-50004314 ACTTTGGAGGCCAAGATGGAAGG + Intronic
1117057523 14:51928271-51928293 ACTTTGGGAGACCAGGTGGGTGG - Intronic
1117427805 14:55619877-55619899 ACTTTGGGGGACCAGTAGGAGGG - Intronic
1118907631 14:70034020-70034042 CCTTTTGGGGACCAGGAGTAAGG - Intergenic
1119837739 14:77765884-77765906 ACTTTGGGAGGCCAGGTGGATGG - Intronic
1120287899 14:82528193-82528215 CCTTTGTGTGGACAGATGGAGGG - Intergenic
1121267267 14:92612434-92612456 CCTTTGGGGCCCTAGAGGGAAGG + Intronic
1122127165 14:99585741-99585763 CCTAAGGGGGCCCAGAGGGAGGG - Intronic
1122338283 14:101007877-101007899 GCTTTGGGAGACCAGGTGGGAGG + Intergenic
1122621368 14:103059261-103059283 CCTTTGGGGTATCAACTGGAAGG + Intergenic
1124175890 15:27423809-27423831 ACTTTGGGGGACCAGGTGGGAGG - Intronic
1124486722 15:30123985-30124007 CTTTAGGAGGACAAGATGGAAGG - Intergenic
1124541800 15:30592962-30592984 CTTTAGGAGGACAAGATGGAAGG - Intergenic
1124756807 15:32414338-32414360 CTTTAGGAGGACAAGATGGAAGG + Intergenic
1125387467 15:39153704-39153726 ACTTTGGGGGCCAAGATGGGAGG - Intergenic
1127543199 15:59963775-59963797 CTTTTGGGGGACGAGGTGGGAGG + Intergenic
1128551511 15:68600810-68600832 CCCGTGGGGGACCAGACTGAGGG - Intronic
1130255876 15:82325885-82325907 CCTCTGGGGACCCAGATGTAGGG - Intergenic
1131464293 15:92643209-92643231 ACTTTGGGGGCCAAGATGGGAGG - Intronic
1132663181 16:1070554-1070576 CCTTTGGAGGAGCGGAGGGAGGG + Intergenic
1133558461 16:6927679-6927701 CCTTTGGGGGAGCAGATTTTAGG + Intronic
1134043152 16:11083405-11083427 ACTTTGGGAGGCCAGGTGGAAGG - Intronic
1134834707 16:17351269-17351291 CTTTTGGAGGCCAAGATGGATGG + Intronic
1138526440 16:57610447-57610469 CCTGTGGGGGACCAAATTGTAGG + Intergenic
1138590124 16:57995244-57995266 CCTGTGGGGGACCTGGTGGATGG - Exonic
1140634492 16:76895274-76895296 CTATTGTGGGACTAGATGGAAGG + Intergenic
1142256583 16:89016990-89017012 CCTTGGGGGTTGCAGATGGAGGG - Intergenic
1143666318 17:8363589-8363611 ACTTTGGAGGCCAAGATGGACGG - Intergenic
1144249716 17:13403489-13403511 TCTCTGGGGTACCAGAAGGAAGG - Intergenic
1144872103 17:18377940-18377962 CCTTTGGGGGACCCCTTGGCTGG - Exonic
1145737167 17:27241054-27241076 CTTTTGGAGGACGAGATGGGTGG + Intergenic
1147638297 17:41977538-41977560 CCTTTGGGGCAGCAGTTGGAAGG - Exonic
1148029838 17:44611929-44611951 ACTTTGGGAGGCCAGGTGGAAGG + Intergenic
1149522512 17:57328391-57328413 CAGATGGGGGACAAGATGGATGG - Intronic
1149998337 17:61416636-61416658 CCTTTGGGGGACCGTAAGGGCGG + Intergenic
1150806890 17:68326421-68326443 CTTTTGGAGGCCCAGGTGGATGG + Intronic
1151414561 17:73952872-73952894 GCTTTGGGGGACCAGAGGGGAGG - Intergenic
1151687820 17:75659595-75659617 CTTTGGGAGGACCAGATGGGAGG - Intronic
1151749185 17:76027122-76027144 CCTTTGGGGGACCCCTTGGCGGG + Exonic
1151957007 17:77385460-77385482 CCTTGGGAGGCCGAGATGGATGG - Intronic
1152038475 17:77888100-77888122 CCTTTGGGGGAGCAGGAGGGAGG - Intergenic
1152950245 17:83225822-83225844 CCTTTGGAGGCCCAGGTGGGAGG + Intergenic
1153664308 18:7354578-7354600 CTTTTTGGAGAACAGATGGAAGG - Intergenic
1155671792 18:28380257-28380279 GCTTTGGGAGACCAGGTGGGTGG + Intergenic
1156029214 18:32692970-32692992 ACTATGGTTGACCAGATGGATGG + Intronic
1157394760 18:47332279-47332301 CCTGTGGGGGAAGAGATGGCTGG - Intergenic
1158440701 18:57471841-57471863 CCTATGTAGGACCACATGGAAGG - Intronic
1160923028 19:1529446-1529468 CCCTTGTGCGACCAGGTGGATGG - Exonic
1161894560 19:7070349-7070371 CATTTTAGGGACCAGATGGCTGG + Intronic
1162272006 19:9623759-9623781 CTTTGGGAGGACCAGGTGGATGG - Intronic
1162519083 19:11168518-11168540 CCTTGTGGGGCCGAGATGGAAGG - Intronic
1162911730 19:13851366-13851388 CCTTTGTGGGAGCAGCTGGGGGG - Intergenic
1163712550 19:18855283-18855305 CTTTAGGGTGGCCAGATGGAAGG + Intronic
1164274767 19:23706554-23706576 ACTTTGGGGGACTATTTGGAAGG + Intergenic
1164486981 19:28666922-28666944 CCTTATGGGGACAAAATGGAAGG - Intergenic
1164988257 19:32665165-32665187 CCTTTGGAGAACAAGCTGGAGGG - Intronic
1165151076 19:33760561-33760583 GCTTTGGAGGCCAAGATGGATGG - Intronic
1165227144 19:34362954-34362976 TATTTTGGTGACCAGATGGACGG - Intronic
1166143975 19:40821856-40821878 CCTTTGTGGGAGCAGATGTGGGG + Intronic
1166183634 19:41125240-41125262 CCTTTGTGGGAACAGATGTGGGG - Intronic
1166808357 19:45500075-45500097 ACTCTGGGGGCCCAGCTGGAGGG + Intronic
1166889717 19:45983276-45983298 CCTGTGGGGGGACAGATGAAGGG - Intergenic
1166998124 19:46729486-46729508 CATGGGGGGGACCAGAGGGAAGG + Intronic
1168093854 19:54103243-54103265 CTTTAGGGGTACAAGATGGAGGG - Intronic
1168337123 19:55603014-55603036 CCGTTGTGGGAGCAGGTGGAGGG + Exonic
926180298 2:10636956-10636978 CCTTGGGAGGCCCAGATGGGTGG + Intronic
926309642 2:11666228-11666250 CCTCTGGGGCAGCAGCTGGAAGG - Intronic
928407976 2:31029417-31029439 TCTGTGGAGGACCAGATGGTCGG - Intronic
930702121 2:54469119-54469141 CCTTTAGGACATCAGATGGATGG + Intronic
931339568 2:61386216-61386238 CTTTTGGAGGCCAAGATGGAAGG + Intronic
932093608 2:68827877-68827899 CCCTTTGAGGACCAGATTGATGG + Intergenic
933537601 2:83596213-83596235 CCTTTGAAGAACCAGATGGTGGG - Intergenic
933738397 2:85513604-85513626 CCTTTAGGGGATCAGAAGGAGGG + Intergenic
934145394 2:89088645-89088667 CTTTTGGAGGCCAAGATGGACGG - Intergenic
934223864 2:90111899-90111921 CTTTTGGAGGTCAAGATGGATGG + Intergenic
935100247 2:99987693-99987715 CCTTTGGGGTAGCAGATGATAGG - Intronic
936104112 2:109610329-109610351 CTTTGGGAGGCCCAGATGGATGG - Intronic
937922720 2:127143228-127143250 CCTTTGGAGGAGCAGAAGGATGG - Intergenic
938270381 2:129965039-129965061 CCTGGGGGGCACCAGATGTAGGG + Intergenic
939225120 2:139354516-139354538 ACTTTGGGGGACCATTGGGAAGG + Intergenic
939704286 2:145432595-145432617 CCTAGGGGGGAGCAAATGGATGG - Intergenic
940408889 2:153336711-153336733 ACTTTGGGGGACCATTGGGAAGG + Intergenic
940785937 2:157981039-157981061 ACTTTGGGGGACTATAGGGAAGG + Intronic
941925010 2:170885744-170885766 CCTGTGGGTGACCCGAGGGATGG - Intergenic
944233160 2:197416060-197416082 ACTTTGGGGGTCCAGGTGGGAGG - Intronic
945120704 2:206454529-206454551 ACTTTGGGGGAACTGTTGGAAGG - Intronic
946964594 2:225024479-225024501 CATTTGGGGGATCTGAAGGAAGG + Intronic
948446996 2:238040611-238040633 CCTTGGGGAGACCAGATCCAGGG + Intronic
1168918444 20:1510919-1510941 CTTTTGGGAGACCAGAAGGATGG + Intergenic
1169260796 20:4136602-4136624 CCTGTGGGGGTCCTGGTGGATGG - Intronic
1169624860 20:7554224-7554246 ACTTTGGGGTATCAGAGGGAAGG - Intergenic
1169816997 20:9667512-9667534 CCTTGGTGGGAACAGATGAAGGG - Intronic
1170553280 20:17495253-17495275 CCTTTGGGCTTCCAGAGGGAAGG + Intronic
1170807668 20:19647168-19647190 TCTCTGGGGGACCATGTGGATGG - Intronic
1172859820 20:38039645-38039667 CTTTTGGAGGCCGAGATGGACGG - Intronic
1173662609 20:44745037-44745059 ACTTTGGGGGAGCAGAAGGAAGG - Intergenic
1174417319 20:50376228-50376250 CCTTTGATGGACCAGAGGTAGGG - Intergenic
1175500933 20:59450284-59450306 CCTGTGTGGGAGCAGAAGGATGG + Intergenic
1175611814 20:60357947-60357969 CCTAGGAGGGACCAGGTGGAAGG + Intergenic
1178046027 21:28695759-28695781 ACTTTGGGGGACCATTGGGAAGG - Intergenic
1178509003 21:33186580-33186602 CCTTTGGGGGACACACTGGAAGG - Intergenic
1179880325 21:44290898-44290920 TCTGTTGGAGACCAGATGGATGG + Intronic
1180907140 22:19422404-19422426 GTTGTGGGGGACCAGAGGGAGGG - Intronic
1180923201 22:19533233-19533255 CCTTTGGGGGCCAAGATGGGTGG + Intergenic
1180952963 22:19728985-19729007 CCTTTGTGGGACAAGACAGATGG + Intergenic
1181178494 22:21051553-21051575 AGGCTGGGGGACCAGATGGAAGG - Intronic
1182293526 22:29299790-29299812 CCTTTGATGGAACAGATGGGAGG + Exonic
1183292856 22:37013369-37013391 CTTTGGGAGGCCCAGATGGAAGG + Intronic
1183961805 22:41415783-41415805 CCTGTGGGAGGCCAGATGGCTGG + Intergenic
1185134529 22:49062231-49062253 CCCTCAGGGGACCAGATGGGTGG + Intergenic
949862897 3:8522525-8522547 CCCTTTGGGGAACTGATGGAAGG - Intronic
950558078 3:13707054-13707076 TCATTGGGGGACCATGTGGAGGG + Intergenic
950558594 3:13709383-13709405 CCTTTGGGGAGCCATGTGGAGGG + Intergenic
951177466 3:19618533-19618555 ACTTTGGGGGACTATAGGGAAGG - Intergenic
951483552 3:23186940-23186962 CCTTTGGGTGACTAGATGGCTGG - Intergenic
951835450 3:26978185-26978207 CCTTAGGGGGCCAAGATGAAAGG + Intergenic
952174271 3:30844386-30844408 GCTTTGTGGAAACAGATGGAAGG - Exonic
952416640 3:33096403-33096425 CGTTTGGGGGTCCAGGTTGAGGG - Intronic
953005011 3:38970045-38970067 TCTTTGGGGGACCAGAAGCCAGG - Intergenic
953324392 3:42000665-42000687 ACTTTGGGGGACCAGGAGGGAGG + Intergenic
953621833 3:44539755-44539777 ACTTTGGGGGCTCAGGTGGAAGG + Intergenic
953639474 3:44692919-44692941 CTTTTGGAGGCCAAGATGGATGG + Intergenic
954264047 3:49459728-49459750 CCTTTGGGGGAACCTCTGGAAGG - Intergenic
954630673 3:52046188-52046210 CCTCTGGGTGCCCCGATGGAGGG - Intergenic
955152127 3:56378063-56378085 CCTTTGGGTTCCCAAATGGAAGG - Intronic
956648721 3:71483081-71483103 ACTTTGGGAGACCAGATGGGTGG - Intronic
957744223 3:84317791-84317813 CCATTGGGTGACGAGAGGGATGG + Intergenic
960517994 3:118623463-118623485 GCTTTGGGGGACCAGGGGAAAGG - Intergenic
960947950 3:122979711-122979733 CCTTGGGAAAACCAGATGGATGG - Intronic
962423570 3:135249461-135249483 CATCTGGGTGACCAGCTGGAGGG - Exonic
964583783 3:158272223-158272245 TCTTTGGGGCACTAGATGAATGG - Intronic
965092489 3:164181078-164181100 ACTTTGGGGGAACGGTTGGAAGG - Intergenic
967808677 3:193736978-193737000 CCAATTGGTGACCAGATGGATGG - Intergenic
968892755 4:3379939-3379961 ACTTTGGGGGAACTGTTGGAAGG - Intronic
971421354 4:26476683-26476705 CCTGTGAGAGAGCAGATGGATGG + Intergenic
971957145 4:33435315-33435337 CCTTTGGGAGGCCAGCTGGGAGG - Intergenic
972164167 4:36261892-36261914 CTTGTGGGGGACCAGGAGGAGGG + Intergenic
972406160 4:38748381-38748403 ACTTTGGGGGACCATTGGGAAGG + Intergenic
973666467 4:53164424-53164446 CCTTTGTGGGACTAGCTGGCTGG - Intronic
975627097 4:76360844-76360866 ACTTTGGGGGACCATTGGGAAGG + Intronic
976052897 4:81030071-81030093 CCTTTTGGGGACCTGTAGGAAGG + Intergenic
976305492 4:83555352-83555374 CCTTTGGGGAGCAATATGGAGGG - Intronic
977203245 4:94140887-94140909 CCATTGGAGGACCAGAGGGCAGG + Intergenic
980279669 4:130703531-130703553 CCTTTGTGGGACCAGATAGCAGG + Intergenic
980758434 4:137196298-137196320 CTTTGGGAGGCCCAGATGGATGG - Intergenic
981034630 4:140156651-140156673 CCTTTGGGGAACCAGCAGGTGGG + Intergenic
981193796 4:141894748-141894770 CTTTTGGGGGCCAAGGTGGATGG - Intergenic
981382914 4:144094399-144094421 ACTTTGGGGGACCGTTTGGAAGG - Intergenic
981483259 4:145259364-145259386 ACTTTGGGGGACTATTTGGAAGG - Intergenic
982015429 4:151148794-151148816 CTTTGGGAGGCCCAGATGGACGG + Intronic
982760747 4:159280052-159280074 CCTCTGGCGAACCATATGGATGG - Intronic
983752268 4:171289677-171289699 CTTTGGGGGGCCCAGGTGGATGG + Intergenic
985141083 4:186840913-186840935 CCTTTGGGGTCCCAGTTGGCAGG + Intergenic
986050079 5:4081782-4081804 CCTTTGGGGGTCCTGGAGGAGGG - Intergenic
987332904 5:16873021-16873043 ACTTTGGGGGACCATTGGGAAGG - Intronic
994218294 5:97164133-97164155 ACTTTGGGGGCCAAGGTGGAAGG - Intronic
994679898 5:102873346-102873368 CCTTTTGGGCACCAGCTGGTGGG + Intronic
994781400 5:104094910-104094932 ACTTTGGGGGACCATTTGAAGGG - Intergenic
995357549 5:111256480-111256502 CCTTTGGGGGAACTGAGTGAAGG + Intronic
995590877 5:113698740-113698762 ACTTTGGGGGACTATTTGGAAGG - Intergenic
997128066 5:131248379-131248401 ACTTTGGGAGGCCAGATGGGCGG - Intronic
998764052 5:145465086-145465108 ACTATGGGGGAACAGGTGGAAGG - Intergenic
999754508 5:154654075-154654097 CCCTGGGGGGACCAGATGGACGG + Intergenic
1000570181 5:162902286-162902308 CTTTTGGAGGCCTAGATGGATGG + Intergenic
1000661442 5:163944130-163944152 CCTTTGGAGGCCTAGTTGGAAGG + Intergenic
1002545557 5:179941442-179941464 CCTTTGGGGATCCCAATGGAAGG + Intronic
1002744478 5:181459634-181459656 CCTTTGGAGGCCCAGGTGGGAGG + Intergenic
1003456700 6:6289499-6289521 CCTTTGGGGGAAAAAAAGGAGGG + Intronic
1003504089 6:6725538-6725560 CCTCTGGTGACCCAGATGGAGGG - Intergenic
1003809858 6:9767696-9767718 CCTCTAGGGGACCATATAGATGG + Intronic
1004068499 6:12275013-12275035 TCTTTGGGGGAAAAGAAGGAAGG - Intergenic
1006020527 6:31115121-31115143 CCTCTGTGGGAGCAGCTGGAAGG + Exonic
1006645707 6:35512757-35512779 CCCTGGGGGGCCTAGATGGAGGG - Intronic
1009748048 6:67846033-67846055 CTCTTGGGGGACCAGGTGCATGG + Intergenic
1012992630 6:105941472-105941494 CATTTGGAGTACAAGATGGATGG - Intergenic
1013287092 6:108691037-108691059 CCTGTGGTGGCCCAGCTGGAAGG + Intergenic
1015105893 6:129536392-129536414 CATCTGGGTGAACAGATGGATGG + Intergenic
1015761545 6:136667474-136667496 CCTTGGGAGGCCCAGGTGGAAGG + Intronic
1016430358 6:143977741-143977763 CCTTTGGAGGCCGAGATGGGTGG - Intronic
1017495202 6:154977622-154977644 CTTTGGGGGGCCAAGATGGATGG - Intronic
1018493331 6:164320318-164320340 GCTTTGGGTGACCAGAAGCAGGG + Intergenic
1019249389 6:170733175-170733197 CCTTTGGAGGCCCAGGTGGGAGG + Intergenic
1019262073 7:87357-87379 CCTCTGTGGGCCCAGATGCAGGG - Intergenic
1019400952 7:853538-853560 GCTCGGGTGGACCAGATGGAAGG + Exonic
1021398202 7:20177116-20177138 CTTTAGGGGAACTAGATGGAAGG + Intronic
1024121703 7:46248577-46248599 TCTTTGGGAGACAAGATGAACGG - Intergenic
1025253316 7:57366306-57366328 CCTTTGATGGACCAGAGGTAGGG + Intergenic
1025999739 7:66551620-66551642 CCTGTGGTGGTTCAGATGGATGG - Intergenic
1026019141 7:66694584-66694606 CCTATGGAGAACCAGCTGGAGGG + Intronic
1026835767 7:73638074-73638096 GCTTTGGGTGTACAGATGGATGG - Intergenic
1029166281 7:98593687-98593709 CCTTTGGTGGCCAAGGTGGAGGG + Intergenic
1029251838 7:99242390-99242412 CTTTTGGGGGCCAAGATGGGAGG + Intergenic
1029605919 7:101599373-101599395 CCTTTTGGGGAATGGATGGAAGG - Intergenic
1030213735 7:107022011-107022033 CCTTAGGGGGACAAGATTGACGG - Intergenic
1030785323 7:113653231-113653253 CCTTTGGGAGAGCCGATGTAGGG + Intergenic
1032360748 7:131252570-131252592 ACTTTGGGAGGCCAGGTGGATGG - Intronic
1035498708 8:74472-74494 CCTTTGGAGGCCCAGGTGGGAGG - Intronic
1035705087 8:1669256-1669278 CATCTGGGGGCCCAGATGGACGG - Intronic
1038427456 8:27473454-27473476 CTTTTGGAGGCCAAGATGGAAGG + Intronic
1043705881 8:83349875-83349897 CTTTGGGAGGACCAGGTGGATGG - Intergenic
1043959574 8:86401314-86401336 ACTTTGGGGGTCAAGATGGGAGG + Intronic
1047381518 8:124368651-124368673 CCTGTGGAGGACCACATGGGAGG + Intronic
1047493789 8:125395398-125395420 CCTTAGAGGGACCAGGTGAATGG - Intergenic
1052009203 9:23385949-23385971 CCTCTGGGGGACTACAGGGAAGG + Intergenic
1056657229 9:88519498-88519520 CCTTTGGGGGCTCAGATGTGGGG + Intergenic
1057968205 9:99525651-99525673 TGTTTGGGGGACCAGAGGCAGGG - Intergenic
1058975915 9:110125439-110125461 CCTTTTAGGGAGCAGAGGGAGGG + Intronic
1059129585 9:111732338-111732360 CTTTGGGTGGACCAGATGGGAGG + Intronic
1060488624 9:124065551-124065573 ACTGTGGGGTGCCAGATGGAGGG - Intergenic
1060984712 9:127813445-127813467 CCTTTGGGGGACTAGGTGGCTGG - Exonic
1061413276 9:130432324-130432346 CCTTTGGGGGACCAGTGAGGTGG - Intronic
1061838140 9:133342581-133342603 CCTTTGGGGGACCAGCAAGAAGG + Intronic
1203610289 Un_KI270748v1:90128-90150 CCTTTGGAGGCCCAGGTGGGAGG + Intergenic
1185782169 X:2858215-2858237 CCTTTGGGGGCCGAGGTGGGCGG + Intronic
1186663001 X:11687933-11687955 CTTTTGTGGGACTAAATGGAAGG + Intergenic
1188050037 X:25473479-25473501 CCTTAGGGAGGCCAGATGCAGGG + Intergenic
1189207609 X:39255383-39255405 CTTTGGGAGGACCAGGTGGAAGG + Intergenic
1190485222 X:50917160-50917182 CTTTTGAGGGACTAGAAGGAAGG + Intergenic
1192103263 X:68288379-68288401 CATTTGTGGGGCCAGTTGGAGGG - Intronic
1196478166 X:116112983-116113005 ACTTTGGGGGACCATTTGGAAGG - Intergenic
1198951075 X:142073178-142073200 CATTTGGAGGATGAGATGGAGGG - Intergenic
1199643975 X:149887376-149887398 CATGAGGGGGACCAGATGAAGGG - Intergenic
1200679546 Y:6194153-6194175 ACTTTGGGGGACCATTGGGAAGG - Intergenic