ID: 1074790391

View in Genome Browser
Species Human (GRCh38)
Location 10:116880853-116880875
Sequence CCAGCCAGACGTTACCACGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1074790384_1074790391 1 Left 1074790384 10:116880829-116880851 CCTTAGCTTCCCTGAATCCCAGT No data
Right 1074790391 10:116880853-116880875 CCAGCCAGACGTTACCACGAGGG No data
1074790383_1074790391 13 Left 1074790383 10:116880817-116880839 CCTGACTGGAGGCCTTAGCTTCC 0: 1
1: 0
2: 1
3: 10
4: 151
Right 1074790391 10:116880853-116880875 CCAGCCAGACGTTACCACGAGGG No data
1074790385_1074790391 -8 Left 1074790385 10:116880838-116880860 CCCTGAATCCCAGTTCCAGCCAG No data
Right 1074790391 10:116880853-116880875 CCAGCCAGACGTTACCACGAGGG No data
1074790386_1074790391 -9 Left 1074790386 10:116880839-116880861 CCTGAATCCCAGTTCCAGCCAGA 0: 1
1: 0
2: 4
3: 32
4: 518
Right 1074790391 10:116880853-116880875 CCAGCCAGACGTTACCACGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1074790391 Original CRISPR CCAGCCAGACGTTACCACGA GGG Intronic
No off target data available for this crispr