ID: 1074791630

View in Genome Browser
Species Human (GRCh38)
Location 10:116894622-116894644
Sequence GAACAGGAGTTCCCTTTCGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1074791626_1074791630 25 Left 1074791626 10:116894574-116894596 CCAAGACGACACAGCTATGAAAG No data
Right 1074791630 10:116894622-116894644 GAACAGGAGTTCCCTTTCGAAGG No data
1074791628_1074791630 -7 Left 1074791628 10:116894606-116894628 CCACACTGTTGAAATGGAACAGG No data
Right 1074791630 10:116894622-116894644 GAACAGGAGTTCCCTTTCGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1074791630 Original CRISPR GAACAGGAGTTCCCTTTCGA AGG Intronic