ID: 1074791630 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 10:116894622-116894644 |
Sequence | GAACAGGAGTTCCCTTTCGA AGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | Yes |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1074791626_1074791630 | 25 | Left | 1074791626 | 10:116894574-116894596 | CCAAGACGACACAGCTATGAAAG | No data | ||
Right | 1074791630 | 10:116894622-116894644 | GAACAGGAGTTCCCTTTCGAAGG | No data | ||||
1074791628_1074791630 | -7 | Left | 1074791628 | 10:116894606-116894628 | CCACACTGTTGAAATGGAACAGG | No data | ||
Right | 1074791630 | 10:116894622-116894644 | GAACAGGAGTTCCCTTTCGAAGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1074791630 | Original CRISPR | GAACAGGAGTTCCCTTTCGA AGG | Intronic | ||