ID: 1074792614

View in Genome Browser
Species Human (GRCh38)
Location 10:116905872-116905894
Sequence ACTGAAGACACGCACAGTTA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1074792611_1074792614 -1 Left 1074792611 10:116905850-116905872 CCATGACCGAGCTGATGAAACCA 0: 1
1: 0
2: 0
3: 11
4: 199
Right 1074792614 10:116905872-116905894 ACTGAAGACACGCACAGTTATGG No data
1074792612_1074792614 -7 Left 1074792612 10:116905856-116905878 CCGAGCTGATGAAACCACTGAAG 0: 1
1: 0
2: 0
3: 11
4: 196
Right 1074792614 10:116905872-116905894 ACTGAAGACACGCACAGTTATGG No data
1074792609_1074792614 9 Left 1074792609 10:116905840-116905862 CCGTTAATTCCCATGACCGAGCT 0: 1
1: 0
2: 0
3: 3
4: 71
Right 1074792614 10:116905872-116905894 ACTGAAGACACGCACAGTTATGG No data
1074792610_1074792614 0 Left 1074792610 10:116905849-116905871 CCCATGACCGAGCTGATGAAACC No data
Right 1074792614 10:116905872-116905894 ACTGAAGACACGCACAGTTATGG No data
1074792608_1074792614 23 Left 1074792608 10:116905826-116905848 CCTCATAAAGGTTTCCGTTAATT No data
Right 1074792614 10:116905872-116905894 ACTGAAGACACGCACAGTTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1074792614 Original CRISPR ACTGAAGACACGCACAGTTA TGG Intronic
No off target data available for this crispr