ID: 1074794396

View in Genome Browser
Species Human (GRCh38)
Location 10:116926815-116926837
Sequence ATAAGACAACCTCCTTGCCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 209
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 197}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1074794396_1074794400 15 Left 1074794396 10:116926815-116926837 CCATGGCAAGGAGGTTGTCTTAT 0: 1
1: 0
2: 1
3: 10
4: 197
Right 1074794400 10:116926853-116926875 GGCATGTGGAACCACAAAAAAGG No data
1074794396_1074794397 -9 Left 1074794396 10:116926815-116926837 CCATGGCAAGGAGGTTGTCTTAT 0: 1
1: 0
2: 1
3: 10
4: 197
Right 1074794397 10:116926829-116926851 TTGTCTTATGTAATTCTAGATGG No data
1074794396_1074794399 1 Left 1074794396 10:116926815-116926837 CCATGGCAAGGAGGTTGTCTTAT 0: 1
1: 0
2: 1
3: 10
4: 197
Right 1074794399 10:116926839-116926861 TAATTCTAGATGGTGGCATGTGG No data
1074794396_1074794398 -6 Left 1074794396 10:116926815-116926837 CCATGGCAAGGAGGTTGTCTTAT 0: 1
1: 0
2: 1
3: 10
4: 197
Right 1074794398 10:116926832-116926854 TCTTATGTAATTCTAGATGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1074794396 Original CRISPR ATAAGACAACCTCCTTGCCA TGG (reversed) Intronic
900684522 1:3939663-3939685 GTATGTCATCCTCCTTGCCAGGG - Intergenic
901578185 1:10217890-10217912 ATAAACAAACCTCCTTGTCATGG - Intronic
902324499 1:15690590-15690612 ATATGAAAAAGTCCTTGCCAAGG + Intronic
904150612 1:28436052-28436074 ATAAGAAAACCTCAATGCTAAGG - Intronic
904798219 1:33073480-33073502 ATAAGACTGCCTGCTTCCCAGGG - Intronic
906292613 1:44629393-44629415 ATAAGACAAGGTCCTTGCCTTGG - Intronic
908259129 1:62326074-62326096 ATAAGACAAGCTTTTTGTCAAGG + Intergenic
908642263 1:66238387-66238409 AAAATCCAAACTCCTTGCCATGG - Intronic
913659928 1:120997801-120997823 AAAATCCAAACTCCTTGCCATGG + Intergenic
914166549 1:145180184-145180206 AAAATCCAAACTCCTTGCCATGG - Intergenic
914649909 1:149689591-149689613 AAAATCCAAACTCCTTGCCATGG + Intergenic
915100316 1:153494646-153494668 ATCAGACATCATCCATGCCAAGG - Intergenic
918305644 1:183243547-183243569 ATAAGACAACCACCTGGCCATGG - Exonic
919790369 1:201286590-201286612 ATCAGACAAGCACCTTGCCCTGG + Intronic
923089312 1:230727307-230727329 ATGAGACAATCTCCCTGCCCTGG - Intergenic
923427856 1:233890205-233890227 ACAAGACACCCTCCCTGCCTGGG - Intergenic
923562132 1:235049415-235049437 AGAAAACAAGCTCCTTCCCAGGG + Intergenic
1062947207 10:1470742-1470764 ATAAAAACACCTCCTGGCCAGGG + Intronic
1063132416 10:3189557-3189579 ACAAGACAACTACCCTGCCAGGG + Intergenic
1063396686 10:5694258-5694280 AAAACACACCCTCCTGGCCATGG - Intronic
1064997227 10:21307000-21307022 AGAAGACAACTTCCTTGGCTGGG + Intergenic
1066962925 10:42236793-42236815 ATAACCCACCCTCCCTGCCATGG + Intergenic
1069078714 10:64065469-64065491 GTAAGGGAACCCCCTTGCCAAGG - Intergenic
1069359853 10:67629785-67629807 ATAAGATTACCTAGTTGCCAGGG - Intronic
1074500871 10:114023087-114023109 ATAGGACAATCTCAATGCCAGGG - Intergenic
1074794396 10:116926815-116926837 ATAAGACAACCTCCTTGCCATGG - Intronic
1074843594 10:117377020-117377042 AGAAGAAAACCTCCAAGCCAAGG + Intergenic
1075555275 10:123426518-123426540 AAAAAAAAAACTCCTTGCCAGGG + Intergenic
1075909689 10:126113300-126113322 ATCACTCAACCTCCTTGCCATGG - Intronic
1079885210 11:25979645-25979667 ATAAGGCAACCTTCTTCCCATGG - Intergenic
1079918692 11:26403687-26403709 ATAAGACAAATTCCTTATCAAGG + Intronic
1080072287 11:28104276-28104298 AAAATACAAACTCCTTACCATGG + Intronic
1080125596 11:28729696-28729718 ATAAGAAAACCCACTTGACAGGG + Intergenic
1081323636 11:41719550-41719572 AAAAGACAATCTCTTGGCCAAGG - Intergenic
1085259949 11:75198913-75198935 ATAAGAAAAACTTCCTGCCATGG + Intronic
1086271486 11:85072537-85072559 TTAACACACCCTCCTTGCCAAGG + Intronic
1090666046 11:128915669-128915691 ATAAGACACAGTCCTTGCCCTGG - Intronic
1090932118 11:131307342-131307364 ATAAGACAAATTCCTGGACATGG + Intergenic
1091104228 11:132903283-132903305 ATAAAACAACCTCCTGTCCTTGG - Intronic
1092893405 12:12990660-12990682 ATAAGACCCCCTTCTTGCCTGGG + Intronic
1093468927 12:19480398-19480420 AAAATAGAACCTCCTTGGCAGGG - Intronic
1095826259 12:46532443-46532465 ACCAGAGAACCTCCTAGCCATGG - Intergenic
1096536470 12:52278246-52278268 ATAATAGGACCTCCCTGCCAGGG - Intronic
1096815671 12:54200334-54200356 ATAAGAAATCCTACTTCCCAGGG - Intergenic
1097289208 12:57899663-57899685 ATAAGATAAACTCCTGGCAATGG + Intergenic
1097430951 12:59506315-59506337 ATAAGGCAACTTTCTAGCCAAGG + Intergenic
1097464582 12:59906616-59906638 ATAAGTTGACCTACTTGCCAAGG + Intergenic
1100918410 12:99454612-99454634 AAAAGACCATCTCCCTGCCATGG - Intronic
1102609392 12:114098130-114098152 ATAATACAACATGTTTGCCATGG + Intergenic
1103936895 12:124481718-124481740 AAAAGCCAAAATCCTTGCCATGG - Intronic
1106296936 13:28422955-28422977 ACCAACCAACCTCCTTGCCATGG + Intronic
1111723764 13:91978676-91978698 ATAAGACTCACTCCTTTCCATGG - Intronic
1115714791 14:36091329-36091351 ATAAATAAAGCTCCTTGCCATGG - Intergenic
1116584971 14:46691944-46691966 CTAAGATAACATCCTTGGCAGGG - Intergenic
1118679939 14:68230471-68230493 ATAAGCCTACCTCTTAGCCAGGG + Intronic
1119624844 14:76164108-76164130 ACAATACCACTTCCTTGCCAGGG - Intronic
1120898102 14:89552498-89552520 ATAAAACAAACTCCTTGCAGGGG + Intronic
1121279584 14:92689071-92689093 AGAAGACCCCCTCTTTGCCATGG + Intergenic
1121358419 14:93233649-93233671 ATAAGTCAACCAGCTTCCCAGGG + Intergenic
1121754979 14:96394598-96394620 ATAAACCAAACTCCTGGCCAAGG - Intronic
1202929433 14_KI270725v1_random:25545-25567 ATAACACACCCTCCCTGCCGTGG - Intergenic
1127311972 15:57760397-57760419 GTAAGAGAACATACTTGCCAGGG + Intronic
1128765899 15:70250960-70250982 ATAAGACGACCGTCTGGCCACGG - Intergenic
1130282503 15:82531026-82531048 AAAAGACCACATCCTTTCCAAGG - Intergenic
1132834160 16:1944151-1944173 AGCAGACCACCTCCTTGCCTGGG + Exonic
1134103287 16:11467996-11468018 AGAAGACCACCTCCAAGCCAAGG + Intronic
1135408626 16:22216571-22216593 ATAAGACAGTGTCCTTGGCATGG + Intronic
1136724093 16:32343234-32343256 ATAACCCACCCTCCCTGCCATGG + Intergenic
1136842427 16:33549278-33549300 ATAACCCACCCTCCCTGCCACGG + Intergenic
1137920055 16:52478174-52478196 AAAATTCAAACTCCTTGCCATGG + Intronic
1138137305 16:54534401-54534423 AAAAGACAAGCTCCTGACCAGGG - Intergenic
1138342943 16:56302628-56302650 AAAAGCCAAACTCCTTCCCATGG + Intronic
1203002338 16_KI270728v1_random:174531-174553 ATAACCCACCCTCCCTGCCATGG - Intergenic
1203133943 16_KI270728v1_random:1710937-1710959 ATAACCCACCCTCCCTGCCATGG - Intergenic
1203152592 16_KI270728v1_random:1849575-1849597 ATAACCCACCCTCCCTGCCACGG + Intergenic
1142865779 17:2790700-2790722 ATGAGACAAGCTCCTTCCCCAGG - Intronic
1143799557 17:9367377-9367399 AGATCACAACCTTCTTGCCAAGG + Intronic
1144527371 17:16001224-16001246 AAAATACAAACTCCTTGCCTTGG + Intronic
1145255966 17:21322574-21322596 ATGAGACAACCTGCTGGCCCTGG + Intergenic
1146159816 17:30553881-30553903 TTGAGCCAACCTCCTTTCCAGGG + Intergenic
1150502143 17:65661016-65661038 TAAAGACAACCTCCTTTGCATGG + Intronic
1152209572 17:78995939-78995961 ATGAGACATTCTCCATGCCAGGG + Intronic
1152684013 17:81684833-81684855 GTGAGACACCTTCCTTGCCAAGG + Intronic
1153877031 18:9383102-9383124 ATAATCCAAACTCCTTTCCATGG - Intronic
1153895307 18:9553722-9553744 ATATGACATCCTTGTTGCCATGG + Intronic
1159116895 18:64124776-64124798 ATAAGACAACCACCTCACAAAGG - Intergenic
1162734505 19:12738637-12738659 CTATGACAACCTCTTTGCTATGG + Exonic
1164936114 19:32215289-32215311 ATAAGACATCCTCCTGGTGAAGG + Intergenic
1165480000 19:36057412-36057434 ATAAGACAACATGAGTGCCATGG + Intronic
1166417111 19:42603461-42603483 ATAAAACAACATCCTTTCCTAGG - Intronic
926772490 2:16390952-16390974 AAAAGACAGCCACCTTGACAAGG + Intergenic
929839512 2:45443074-45443096 AAAATTCAAACTCCTTGCCATGG - Intronic
930590647 2:53322749-53322771 AAAATACAAACTCCTTACCATGG + Intergenic
931281636 2:60798968-60798990 CTAAGACAACAGCTTTGCCAAGG - Intronic
933070562 2:77852879-77852901 ATAACACAACCTCCTAGCTCAGG + Intergenic
934237917 2:90247770-90247792 ATAACCCACCCTCCCTGCCATGG - Intergenic
935266781 2:101401751-101401773 ATAAAACAACCTCCTGTCTAGGG + Intronic
935512349 2:103991605-103991627 ACAAGTCAACCTCCTTTCCCTGG - Intergenic
936440924 2:112552389-112552411 ATAAGACAAAGTCCTTGCTTTGG - Intronic
938292254 2:130156458-130156480 CCAAGACCCCCTCCTTGCCAAGG + Intronic
938464296 2:131516509-131516531 CCAAGACCCCCTCCTTGCCAAGG - Intergenic
938991732 2:136636559-136636581 AGAAAGCAAACTCCTTGCCATGG + Intergenic
939844600 2:147228090-147228112 AAAAGACAGCCTTCTTGCCTGGG - Intergenic
939844706 2:147229162-147229184 AAAAGACACCCTTCTTGCCTGGG + Intergenic
941083161 2:161085990-161086012 ATAATATAAGCTCCTTGGCATGG - Intergenic
941369187 2:164643399-164643421 AAAACCCAAGCTCCTTGCCATGG + Intergenic
941502733 2:166300163-166300185 AAAATACAAACTCCTTCCCATGG + Intronic
944162028 2:196672760-196672782 ATAAGACATAGCCCTTGCCATGG - Intronic
945404901 2:209433499-209433521 AAAAGACAAACTCCTTATCAGGG - Intronic
946504800 2:220287492-220287514 ATAAGACACACTCCTTGACTTGG + Intergenic
948338895 2:237233410-237233432 CTCAGACAACCTCTTTTCCAAGG - Intergenic
1168984907 20:2039605-2039627 ATAAGACATGCTACCTGCCATGG + Intergenic
1169288447 20:4328780-4328802 AGAAGTCATCCTGCTTGCCAGGG - Intergenic
1169439459 20:5622042-5622064 ATAAGACATAGTCCTCGCCAGGG - Intergenic
1169806818 20:9568110-9568132 AAAAGCCAACGTCTTTGCCAAGG - Intronic
1169919432 20:10718744-10718766 ATAAATCAACCTCCTAACCAGGG - Intergenic
1169938600 20:10912482-10912504 TTAAGGCAGCCTCCTGGCCAAGG + Intergenic
1172008557 20:31833438-31833460 AAAAGATAAACCCCTTGCCATGG - Intronic
1173704577 20:45100701-45100723 ATTAGAAAACCTCCCTGGCAGGG - Intronic
1173864113 20:46303262-46303284 AGAAGGCAGCCTCCATGCCAAGG - Intronic
1178105524 21:29314975-29314997 TTAAGACAACATTCTTCCCAAGG - Intronic
1178434407 21:32545367-32545389 CTAAGACCCCCTCCTTCCCAGGG + Intergenic
1179232579 21:39518496-39518518 AAAAGACAAGCTTCTTGCTATGG + Intergenic
1180436935 22:15315219-15315241 TTAAGACAACCGTCTTGCAAAGG - Intergenic
1182651306 22:31853364-31853386 CCAAGACTTCCTCCTTGCCACGG + Intronic
1183724385 22:39580437-39580459 ACACGAAAACCTCCATGCCAGGG - Intronic
1184686161 22:46097316-46097338 ATAAGACATGATCCATGCCATGG + Intronic
1184719282 22:46300446-46300468 AAAATAAAAGCTCCTTGCCATGG + Intronic
1185415573 22:50707602-50707624 TTAAGACCACCTGCTTGGCATGG - Intergenic
949829716 3:8200999-8201021 AAAATACAAACTCCTTCCCATGG - Intergenic
950336168 3:12195222-12195244 TTAAGACAACCTCCTTGGAAAGG - Intergenic
951263552 3:20540425-20540447 AAAAGACACCCTTCTTGCCTGGG - Intergenic
951848736 3:27114521-27114543 ATAAGAAAAACTCCTTGAAATGG + Intronic
952551560 3:34484532-34484554 AAAAGATAACCCCTTTGCCAAGG + Intergenic
954373099 3:50179618-50179640 ATAAAACAGCCTTCTGGCCAGGG - Intronic
954831266 3:53423139-53423161 GAAAGACAACCACATTGCCAAGG - Intergenic
955169222 3:56546969-56546991 ATAAGATAACATTTTTGCCAAGG - Intergenic
955916972 3:63916149-63916171 ATAATACTACCTACTTCCCAAGG + Intronic
958606430 3:96364293-96364315 ATGAGGGAACCTCATTGCCATGG - Intergenic
961344479 3:126254589-126254611 AGAAGACAGCATCCTTGACATGG + Intergenic
962350506 3:134652409-134652431 ATAAGACAACAGCCTTTACACGG - Intronic
962697256 3:137962503-137962525 ATAAGTCAACCTCATTTCAAAGG - Intergenic
963097840 3:141564569-141564591 CTAAGACAACAGTCTTGCCAAGG - Intronic
964352125 3:155813710-155813732 AAGATACAACCTCCTTTCCAAGG + Intergenic
965771812 3:172189428-172189450 AACAGACTACCTCGTTGCCATGG - Intronic
965912355 3:173794412-173794434 ATAATCCAACCTCCCTGCCATGG - Intronic
967788884 3:193526278-193526300 ATAAGACCATGTCCTTGGCAGGG + Intronic
968392690 4:205803-205825 TGAGGACACCCTCCTTGCCAGGG - Intergenic
971273583 4:25174307-25174329 ATAAGAAAACCCACTTGACATGG + Intronic
976543195 4:86301600-86301622 ATACCAGAAACTCCTTGCCAGGG + Intronic
977210745 4:94214849-94214871 ATATGACAACCACCTTGAAAAGG - Intronic
977735966 4:100416134-100416156 AAAAGACAAAGTTCTTGCCATGG - Intronic
982487011 4:155978064-155978086 AAAAGACCACCTTCTTGCCTGGG - Intergenic
986635191 5:9814361-9814383 ATAAGAGAACATTCTTGCCATGG - Intergenic
987316616 5:16730418-16730440 ATAAGCCTCCCTCCTTCCCAGGG - Intronic
987754505 5:22083617-22083639 ATAATACCACCTCCTTCACAGGG - Intronic
990137010 5:52658103-52658125 GTAATCCAACCTCCATGCCATGG + Intergenic
990391965 5:55332451-55332473 CTAAGACAACCACCATGCCAAGG - Intronic
992984320 5:82211977-82211999 ATCACACAACCCCCTTGTCAAGG + Intronic
994412936 5:99432138-99432160 ATAAGTCATCCTCCTTCCCATGG - Intergenic
994661190 5:102656461-102656483 ATAAAACAACCTGCCTGCCTTGG + Intergenic
995260541 5:110098807-110098829 CTAAGAAAACCCCATTGCCAAGG - Intergenic
998365338 5:141627041-141627063 ATAATTCAAACTCCTTACCAGGG + Intronic
999681272 5:154062686-154062708 AAAATCCATCCTCCTTGCCATGG + Intronic
1000418341 5:161008133-161008155 ATAGTACAACTTCCATGCCATGG + Intergenic
1000930539 5:167245966-167245988 AAATGACAGCCTCCATGCCATGG + Intergenic
1001222462 5:169913425-169913447 ATAGAACAAGCTCATTGCCAAGG + Intronic
1003114064 6:3271690-3271712 AAGAGACAGCCTCCTTGGCAAGG - Exonic
1003189474 6:3861655-3861677 ATCACACACCGTCCTTGCCAAGG - Intergenic
1005271293 6:24166202-24166224 AGAAGGGAACCTCCTGGCCAAGG + Intergenic
1005419079 6:25630607-25630629 ATAATACTACCTACTTCCCAGGG - Intergenic
1005836478 6:29713283-29713305 ATAAGATAGAATCCTTGCCATGG + Intergenic
1009797360 6:68488161-68488183 AGGAGAAAAACTCCTTGCCATGG - Intergenic
1010658294 6:78538677-78538699 ATAATGAAAACTCCTTGCCATGG - Intergenic
1013345673 6:109257805-109257827 AAAAAACATTCTCCTTGCCAAGG - Intergenic
1017616256 6:156249864-156249886 CTAAGACCTCCTCCTTCCCAGGG + Intergenic
1022684872 7:32587361-32587383 ATAACAAAACCTACCTGCCAGGG - Exonic
1023830703 7:44037514-44037536 ATTATACATCTTCCTTGCCAGGG - Intergenic
1024405513 7:48975029-48975051 ATAAGAAAACCTGCTTTCTAGGG + Intergenic
1029741035 7:102491831-102491853 ATTATACATCTTCCTTGCCAGGG - Intronic
1029759027 7:102591001-102591023 ATTATACATCTTCCTTGCCAGGG - Intronic
1034431272 7:151042381-151042403 ATATGACAGGCTCCTGGCCAGGG + Intronic
1037941949 8:22958236-22958258 ACAAGACAGCCTGCTTGACAAGG + Intronic
1045668586 8:104519765-104519787 ATAAGATTTCCTACTTGCCATGG - Intronic
1047905148 8:129465138-129465160 ATTAGACAAGCTTCTTGCAATGG - Intergenic
1048360934 8:133696773-133696795 AAAACCCAAACTCCTTGCCAAGG + Intergenic
1048736104 8:137503810-137503832 ATACATCCACCTCCTTGCCATGG - Intergenic
1050330873 9:4544876-4544898 GCAAGACAACCTCCTTCACAAGG + Intronic
1057934981 9:99229670-99229692 AAAAGACAACCTTCTTGAGAAGG - Intronic
1058886979 9:109329297-109329319 ATAAAAACACCTCCCTGCCAGGG - Intergenic
1060707261 9:125815396-125815418 ATAAGCCAAATTCCTTACCATGG - Intronic
1060781004 9:126412782-126412804 ATAAGACAATCTTTTTTCCATGG - Intronic
1061903629 9:133685459-133685481 ATAAGACAGCCACCTTCCAACGG + Intronic
1062513850 9:136922455-136922477 AGAAGACCACCTCCGTGGCAGGG - Intronic
1185937508 X:4275472-4275494 ATAACACAACCTCTGTACCATGG + Intergenic
1187194905 X:17073802-17073824 AAAAGACAACCCCCTTTCAAGGG + Intronic
1187194910 X:17073813-17073835 AAAAGACAACCCCCTTGAAAGGG - Intronic
1189935896 X:46067711-46067733 AAAAGACATCCTCCTTATCATGG - Intergenic
1190702124 X:52996917-52996939 GTAAGTCAAAGTCCTTGCCATGG - Intergenic
1190774274 X:53540237-53540259 AAAAGACAGCCTACTTTCCAAGG - Intronic
1193453982 X:81706676-81706698 ATTAGACAACCTCATTACAAGGG + Intergenic
1193700081 X:84749330-84749352 AAAAGACACCCTTCTTGCCCAGG + Intergenic
1196290705 X:113937350-113937372 AGAAGACATCCTTCTTGCCATGG + Intergenic
1197080970 X:122416015-122416037 CTAAGACATAGTCCTTGCCATGG + Intergenic
1198089874 X:133318043-133318065 ATAAGTCAACCCCCTTGAAAAGG + Intronic
1199149062 X:144407505-144407527 ATAAGACACACTCCTTTCCCAGG - Intergenic
1199370797 X:147045059-147045081 ATAAGACAAAATTGTTGCCATGG - Intergenic
1199658556 X:150023044-150023066 ATATTACAACCTCTTTACCAGGG - Intergenic
1202584112 Y:26406474-26406496 ATAACCCACCCTCCCTGCCATGG + Intergenic