ID: 1074794400

View in Genome Browser
Species Human (GRCh38)
Location 10:116926853-116926875
Sequence GGCATGTGGAACCACAAAAA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1074794396_1074794400 15 Left 1074794396 10:116926815-116926837 CCATGGCAAGGAGGTTGTCTTAT 0: 1
1: 0
2: 1
3: 10
4: 197
Right 1074794400 10:116926853-116926875 GGCATGTGGAACCACAAAAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1074794400 Original CRISPR GGCATGTGGAACCACAAAAA AGG Intronic
No off target data available for this crispr