ID: 1074796878

View in Genome Browser
Species Human (GRCh38)
Location 10:116955640-116955662
Sequence CAGATCTCCCAGATTAAAGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 129
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 122}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1074796878_1074796884 10 Left 1074796878 10:116955640-116955662 CCCACTTTAATCTGGGAGATCTG 0: 1
1: 0
2: 0
3: 6
4: 122
Right 1074796884 10:116955673-116955695 CAATAATATGGAACCTAAAGTGG No data
1074796878_1074796886 20 Left 1074796878 10:116955640-116955662 CCCACTTTAATCTGGGAGATCTG 0: 1
1: 0
2: 0
3: 6
4: 122
Right 1074796886 10:116955683-116955705 GAACCTAAAGTGGCATGGTCTGG No data
1074796878_1074796880 -2 Left 1074796878 10:116955640-116955662 CCCACTTTAATCTGGGAGATCTG 0: 1
1: 0
2: 0
3: 6
4: 122
Right 1074796880 10:116955661-116955683 TGATTTCTACCCCAATAATATGG No data
1074796878_1074796885 15 Left 1074796878 10:116955640-116955662 CCCACTTTAATCTGGGAGATCTG 0: 1
1: 0
2: 0
3: 6
4: 122
Right 1074796885 10:116955678-116955700 ATATGGAACCTAAAGTGGCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1074796878 Original CRISPR CAGATCTCCCAGATTAAAGT GGG (reversed) Intronic
900850772 1:5141195-5141217 CAGAGCTTCCAGATAAAAGGTGG + Intergenic
900919060 1:5659294-5659316 CAGATGTCCAAGATCAAGGTGGG + Intergenic
902518412 1:17002176-17002198 CAGTTCCCCCAGCTGAAAGTGGG - Intronic
904287749 1:29462883-29462905 CAGATCTCCCAGAACCCAGTGGG + Intergenic
905744474 1:40402861-40402883 CAAGTTTACCAGATTAAAGTAGG + Intronic
906519685 1:46459669-46459691 GAGATGTCCCAGATTGAAGTGGG - Intergenic
908712829 1:67036820-67036842 CAGAACTACCAGAACAAAGTGGG - Intronic
910042586 1:82871039-82871061 CAGATCTTCCAGGTTATATTAGG + Intergenic
911109370 1:94166161-94166183 CAGATCCCCCTGATGAAACTAGG - Intronic
912001372 1:104838815-104838837 AAGACCTCACAGATTAATGTTGG - Intergenic
912626081 1:111205182-111205204 CAGATCTCCCAGGAGGAAGTGGG - Intronic
912719976 1:112011890-112011912 CAGATCACCCAGACTAGAATTGG - Intergenic
914445676 1:147748874-147748896 CTGATGTCCCAGAGTATAGTTGG + Intergenic
915472544 1:156134670-156134692 CTCAGCTCCCAGGTTAAAGTGGG + Intronic
915747263 1:158172853-158172875 CACATCTCTCAGCTCAAAGTGGG + Intergenic
915948460 1:160171402-160171424 CAGACCTCCCAGTTCTAAGTAGG - Exonic
923065793 1:230516148-230516170 CACATTTCCCATCTTAAAGTAGG - Intergenic
923443217 1:234040812-234040834 GACATATCCCAGAATAAAGTCGG - Intronic
1063435101 10:6023058-6023080 CAGGTCTCCCAGATTAGATGAGG - Intronic
1068281739 10:54880661-54880683 CTTATCTCACAGATTAAAATTGG + Intronic
1071249374 10:83801384-83801406 CAGAGCAGCCAGAATAAAGTAGG - Intergenic
1073081225 10:100862247-100862269 CAAATGTCCCAGATTCATGTTGG + Intergenic
1074455433 10:113591697-113591719 CTTATCTCCCAGATTAATGTAGG - Intronic
1074796878 10:116955640-116955662 CAGATCTCCCAGATTAAAGTGGG - Intronic
1076258515 10:129047468-129047490 CAGCTCTCCCTGATTTAACTTGG + Intergenic
1077352756 11:2100496-2100518 CAGACAGCCCAGATTACAGTGGG + Intergenic
1079174821 11:18129465-18129487 CAAACCTCCTAGATTAAACTAGG + Intronic
1079178384 11:18165451-18165473 CAAACCTCCTAGATTAAACTAGG + Intronic
1081202227 11:40230502-40230524 CAGAACTCCCAGACTTCAGTTGG + Intronic
1081598131 11:44473373-44473395 CAGAGCTCCCAGCTCAAAGGAGG - Intergenic
1086844251 11:91729446-91729468 CAGCCCTCCTAGATTAAATTTGG + Intergenic
1087472523 11:98595264-98595286 AAGATCTCCCAAAGTAAAATTGG + Intergenic
1087984020 11:104655054-104655076 CAGATCTCCAAAATCATAGTGGG - Intergenic
1088339130 11:108743171-108743193 CAGATCTGCCACAATCAAGTAGG + Intronic
1090328823 11:125913222-125913244 CAGATCTACCAGACTGAAGCTGG - Intronic
1101978413 12:109383330-109383352 CAGTTCTCCCATGTTAAACTTGG - Intronic
1103013425 12:117475535-117475557 CTGATCTCCCAGATTGGATTTGG + Intronic
1108831923 13:54490024-54490046 CAACTCTCCTAGATTAAACTAGG + Intergenic
1110428732 13:75399153-75399175 AAGATCTCCCAAAATAAAGGAGG + Intronic
1111012516 13:82329968-82329990 CAAATCTCCTGGATTAAAGGTGG - Intergenic
1111816089 13:93154458-93154480 TTGATCTCCCAGATTAAACCTGG - Intergenic
1112208924 13:97353906-97353928 CAGAGCTACCACTTTAAAGTAGG - Intronic
1114391092 14:22309378-22309400 CAGATCATCAAGATGAAAGTGGG + Intergenic
1117385889 14:55212434-55212456 CATATTTCAGAGATTAAAGTTGG + Intergenic
1119812145 14:77531089-77531111 CAGAAATCCTAGATTAAAATGGG - Intronic
1120292080 14:82588490-82588512 CACATTTCCCAAATAAAAGTGGG + Intergenic
1120957444 14:90095205-90095227 TAGATATCACAGATTAATGTAGG - Intronic
1120995304 14:90413069-90413091 CAGTTCTTACATATTAAAGTTGG - Intergenic
1128835085 15:70803024-70803046 CAGATCTCCCAGAAGAAATGAGG - Intergenic
1131371068 15:91882366-91882388 CATAGCTCCCAGTTTAAGGTTGG + Intronic
1131602370 15:93862660-93862682 CATATCTCCCAAATTTATGTGGG + Intergenic
1134291361 16:12904440-12904462 CAGAACGCCCAGATCAAAGAGGG - Intronic
1142333579 16:89471991-89472013 CACATCTCCTAGAATAAAATGGG + Intronic
1144276674 17:13676063-13676085 CAGCCCTCCTAGATTAAACTAGG + Intergenic
1148912078 17:50948243-50948265 CACAGCTCCCAGACTAAAGATGG - Intergenic
1149025269 17:52019718-52019740 CAGAAGCCCCAGATCAAAGTAGG + Intronic
1153425360 18:4957145-4957167 CAACCCTCCCAGATTAAACTAGG + Intergenic
1153518188 18:5924639-5924661 GAGATCTCCAAAATTAAAGATGG + Intergenic
1156102655 18:33616689-33616711 CAGAAAGCCCAGATTAAGGTTGG + Intronic
1157427023 18:47592896-47592918 CTGATCTCCAAGATTATATTAGG - Intergenic
1166327936 19:42062634-42062656 CAGATCCCCCACATCAAGGTGGG - Exonic
1166955820 19:46464178-46464200 CCCATCTCTCAGATTAAAGCTGG + Intergenic
927408893 2:22802931-22802953 CAGATCTTTCAGATTCAAGAAGG - Intergenic
932205553 2:69878294-69878316 CAAATCACCCAGATGAAGGTCGG - Intronic
935000985 2:99014918-99014940 CAACTCTCCCAGATTAAATCAGG + Intronic
935644730 2:105324912-105324934 CAGGATTCCCAGATTAATGTCGG - Intronic
937008737 2:118542720-118542742 CAGATCACCCTGCTTAAAGCTGG + Intergenic
937513252 2:122622981-122623003 CAAATCCCCTAGATTAAAGTAGG - Intergenic
941146832 2:161858382-161858404 CAGATCTGCCAGATACAAATGGG - Intronic
942203878 2:173600160-173600182 CAGATCACCCAGATACATGTAGG - Intergenic
946088232 2:217196000-217196022 CAGATCTCCCAGTACCAAGTTGG + Intergenic
1170058755 20:12237390-12237412 CTCACCCCCCAGATTAAAGTGGG - Intergenic
1178150762 21:29790986-29791008 CAGACCACCCAATTTAAAGTTGG - Intronic
1180719372 22:17895813-17895835 AAGATTTCCCAGATGAAATTGGG - Intronic
1183725103 22:39584233-39584255 CAGATCTCCGAGATAGATGTGGG + Intronic
949114716 3:306481-306503 CAAATCTCTCTGATTATAGTTGG + Intronic
950145135 3:10643733-10643755 CAGATGTTCCAAATTAAAGGAGG + Intronic
951051751 3:18101676-18101698 CAAATGTCCCACATTAAAGAAGG - Intronic
951974674 3:28491881-28491903 CAGATCTCCTCTCTTAAAGTTGG - Intronic
952030708 3:29139217-29139239 AGCATCTCCAAGATTAAAGTTGG + Intergenic
952265385 3:31780737-31780759 CAGCTCTCCTGGATTAAATTAGG + Intronic
952952391 3:38535515-38535537 GAACTCTCCCAGATTAAAGGAGG - Intronic
953605053 3:44407025-44407047 AAGATTTCCCAGATAAAAGCAGG - Intronic
957733493 3:84175869-84175891 CAGCTCTATCAGATTAAATTTGG + Intergenic
964818305 3:160741001-160741023 CTGATCTTCCAAATCAAAGTGGG + Intergenic
971406530 4:26325864-26325886 CAGATCTACCAGACTACAGTTGG + Intronic
972152426 4:36110348-36110370 CAGATCTTCCACATCATAGTAGG + Intronic
972579124 4:40379536-40379558 CACATCTCACAGATTCAAGAGGG + Intergenic
973868295 4:55137227-55137249 CTGATCCCCCATATTAAAGGTGG + Intergenic
975850196 4:78564314-78564336 CAAATCTCCCAGAATACAATAGG + Intronic
976064484 4:81168606-81168628 GAGATCACCTAGATTCAAGTGGG + Intronic
976424975 4:84892592-84892614 TAGATCTCCCAGTTTATACTGGG + Intronic
976643656 4:87364747-87364769 CAGATCTCCAAAATTAAAGGTGG - Intronic
980263165 4:130480806-130480828 CAGATCAGTCAGATTAAAGTGGG + Intergenic
983151566 4:164288819-164288841 AAGATTTCTGAGATTAAAGTCGG - Intronic
986088381 5:4477010-4477032 CACATCTCCAGGATTAAACTAGG + Intergenic
990677428 5:58203481-58203503 AAGATCTCCCATCTTGAAGTTGG + Intergenic
995414678 5:111895797-111895819 CAAATGTCCCAGAGTAAATTTGG - Intronic
996009639 5:118467672-118467694 CAGATCTACCAGAGCAAAGCTGG + Intergenic
997508421 5:134436558-134436580 CAGATTTCCCAGATGAAACCTGG - Intergenic
998722088 5:144964291-144964313 GAAATCTCTCAGATAAAAGTGGG + Intergenic
998897175 5:146812003-146812025 CTGATCTCTTAGATTAAACTGGG - Intronic
1002669470 5:180854842-180854864 CAAATGTTCCAGATTAAAGAAGG + Intronic
1006078122 6:31547469-31547491 CAGATCTCCCAGGGGAAACTAGG - Intronic
1010647549 6:78409806-78409828 CAACTCTCCCAGATTAAATCAGG - Intergenic
1010859403 6:80888389-80888411 CAAAGGTCCCAGATAAAAGTGGG - Intergenic
1013055011 6:106574872-106574894 CTGACCAGCCAGATTAAAGTGGG - Intronic
1013153183 6:107466402-107466424 CAGATGTCCCAGATTGATGAAGG + Intergenic
1013328615 6:109074635-109074657 CAGATCACCCAAAGTCAAGTTGG - Intronic
1013922539 6:115425343-115425365 CAGATCTCTCAGAATAATTTAGG + Intergenic
1016905207 6:149142388-149142410 CGGATCTAACAGATTAAAGAGGG + Intergenic
1019122829 6:169817613-169817635 CAACTCTCCTAGATTAAACTGGG - Intergenic
1020671941 7:11127178-11127200 CAGGTTTCCCAGTTTAAAGGAGG - Intronic
1025249852 7:57344377-57344399 CACATCACACAGAGTAAAGTGGG + Intergenic
1026996396 7:74619589-74619611 CAGATCTCCAAGATCCAAGGGGG + Intergenic
1030836070 7:114287437-114287459 TAAATCTCTCAGATTAAAGAAGG + Intronic
1031030903 7:116734074-116734096 CTGCTCTGACAGATTAAAGTGGG - Intronic
1035318824 7:158015070-158015092 CAAATCCCTCAGATAAAAGTGGG + Intronic
1037228540 8:16625406-16625428 TAGATGTCCCAGCTAAAAGTAGG - Intergenic
1037474208 8:19240331-19240353 CAGATGTCCCAGATCAAACAGGG - Intergenic
1041150585 8:54928854-54928876 CAACCCTCCTAGATTAAAGTGGG + Intergenic
1042503595 8:69536586-69536608 CACATTTCCCAGGCTAAAGTGGG + Intronic
1045273218 8:100679515-100679537 CAAATTTCCCAAATCAAAGTGGG - Intergenic
1051929731 9:22370484-22370506 CAACTCTCCCAGATTAAACCAGG + Intergenic
1186621918 X:11250680-11250702 CATATCTCCCTGATTACAGCTGG + Intronic
1190537338 X:51442151-51442173 CAGCTCTCACAGGTTAGAGTAGG - Intergenic
1192801222 X:74466330-74466352 CTGTTCTCCCACAGTAAAGTAGG - Intronic
1193689770 X:84626653-84626675 CAAATCTCCTAGATTAAATCAGG - Intergenic
1196569263 X:117246646-117246668 AAGAACTGCCAGATCAAAGTGGG - Intergenic