ID: 1074803340

View in Genome Browser
Species Human (GRCh38)
Location 10:117024721-117024743
Sequence CTACACATGCTGAAGTAGTT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1074803339_1074803340 25 Left 1074803339 10:117024673-117024695 CCTTAAAGAAAAAAAAGGATCAT 0: 1
1: 0
2: 9
3: 135
4: 1315
Right 1074803340 10:117024721-117024743 CTACACATGCTGAAGTAGTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1074803340 Original CRISPR CTACACATGCTGAAGTAGTT AGG Intronic
No off target data available for this crispr