ID: 1074807543

View in Genome Browser
Species Human (GRCh38)
Location 10:117068362-117068384
Sequence CTGGTTCCTAAATGCAGTGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 161
Summary {0: 1, 1: 0, 2: 3, 3: 11, 4: 146}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1074807543_1074807547 1 Left 1074807543 10:117068362-117068384 CCTGCACTGCATTTAGGAACCAG 0: 1
1: 0
2: 3
3: 11
4: 146
Right 1074807547 10:117068386-117068408 AGGTTGCAACGATCTTTACTGGG No data
1074807543_1074807546 0 Left 1074807543 10:117068362-117068384 CCTGCACTGCATTTAGGAACCAG 0: 1
1: 0
2: 3
3: 11
4: 146
Right 1074807546 10:117068385-117068407 AAGGTTGCAACGATCTTTACTGG No data
1074807543_1074807549 22 Left 1074807543 10:117068362-117068384 CCTGCACTGCATTTAGGAACCAG 0: 1
1: 0
2: 3
3: 11
4: 146
Right 1074807549 10:117068407-117068429 GGTCCGCCCAATATAGTAGTGGG No data
1074807543_1074807548 21 Left 1074807543 10:117068362-117068384 CCTGCACTGCATTTAGGAACCAG 0: 1
1: 0
2: 3
3: 11
4: 146
Right 1074807548 10:117068406-117068428 GGGTCCGCCCAATATAGTAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1074807543 Original CRISPR CTGGTTCCTAAATGCAGTGC AGG (reversed) Intronic
904335311 1:29793481-29793503 CTGGTTCATAGATGCAGGTCAGG - Intergenic
908227539 1:62071255-62071277 CATGTTCCTAAATGCACTACAGG - Intronic
908441547 1:64159931-64159953 TTAGTTCCAAGATGCAGTGCAGG - Intronic
910271854 1:85404408-85404430 CTGCTTCCCAAAAGCAGTTCTGG - Intronic
910424626 1:87108220-87108242 CTGGTTCCCAAATGCATAGCTGG + Exonic
913082187 1:115398981-115399003 CCAGTTCCATAATGCAGTGCAGG - Intergenic
916755761 1:167768836-167768858 CTGGTTCAGAAATGCAAGGCAGG + Intronic
919395495 1:197042402-197042424 CTGGTTCTTAATAGAAGTGCTGG - Intronic
921334435 1:214072200-214072222 CTGGTTCTTACAGGCTGTGCTGG - Intergenic
922614725 1:226955046-226955068 CTGGAACCTAAAGGCAGTGGAGG + Intronic
922788515 1:228296020-228296042 GTGCTTCCAAAATGCAGTGGTGG + Intronic
922944440 1:229499683-229499705 CAGTTTCCTAACAGCAGTGCAGG - Exonic
1063820470 10:9829221-9829243 CTGGTGCCTAAATACAGTCTCGG + Intergenic
1067847509 10:49735840-49735862 CAGGTTCCTTAATACAGTTCTGG + Intronic
1068666560 10:59682184-59682206 CTGGTCCCTACAAGCAGGGCTGG + Intronic
1070912888 10:80133444-80133466 CTGGTTCCTTAAGGCTGTGCTGG - Intronic
1074405197 10:113175525-113175547 CTGGATTCTAAAGGTAGTGCTGG + Intergenic
1074807543 10:117068362-117068384 CTGGTTCCTAAATGCAGTGCAGG - Intronic
1075995181 10:126871336-126871358 CTGAGTGCTAAATGCAGTGTGGG - Intergenic
1078252245 11:9625859-9625881 CTGGTTCCTCACTGAAGTGTGGG - Intergenic
1078660608 11:13282593-13282615 CTGGGTCCTAAAAGCAGAGGAGG - Intronic
1084036405 11:66513979-66514001 CTGGTTTCCAAATGCAGGGCAGG - Intronic
1085131297 11:74041294-74041316 CTTTTTCCTACATGCACTGCTGG + Intronic
1088599143 11:111460173-111460195 CTGGTTTCTAAAGCCAGTGGTGG + Intergenic
1089062872 11:115640454-115640476 CTGGTTCCTAATCCCAGGGCAGG + Intergenic
1091445684 12:543203-543225 CAGGTTCCTGAAAGAAGTGCTGG + Intronic
1095616866 12:44200692-44200714 AGGGTTCCCAAATGCAGTGACGG + Intronic
1098865457 12:75757770-75757792 CTGGTTCCTAACTTGAGGGCTGG + Intergenic
1109855358 13:68119882-68119904 CTGGTTCCTGCCTGCAGTCCTGG - Intergenic
1114046594 14:18881356-18881378 CTGGCTCCTTAAGGCTGTGCTGG - Intergenic
1114117617 14:19638091-19638113 CTGGCTCCTTAAGGCTGTGCTGG + Intergenic
1117065574 14:52010496-52010518 CTGGTTTCTAAATGTGCTGCTGG + Exonic
1118103362 14:62630186-62630208 TTGGTTCCTAAATGCAGAGTTGG - Intergenic
1120765315 14:88323113-88323135 CTGCTTCCCAAAAGCGGTGCCGG + Exonic
1121465647 14:94113937-94113959 CTGGTCCCAAATTGCAGTTCTGG + Intronic
1121529497 14:94642345-94642367 CAGGTTCCTTAATACAGTGGTGG - Intergenic
1122099232 14:99394155-99394177 CTGGTTCCTGACTGCAGTGCTGG - Intergenic
1122229705 14:100299634-100299656 CAGAGTCCTAAATGCTGTGCAGG + Intronic
1123819076 15:24008814-24008836 CTGGATCCTAAATTCTTTGCTGG - Intergenic
1123832190 15:24151551-24151573 CTGGATCCTAAATTCTTTGCCGG + Intergenic
1123847709 15:24320022-24320044 CTGGATCCTAAATTCTTTGCTGG - Intergenic
1123866751 15:24527402-24527424 CTGGATCCTAAATTCTTTGCTGG - Intergenic
1124614965 15:31234909-31234931 CTGGGTCCTAGATGCAGTGTGGG + Intergenic
1125508586 15:40281324-40281346 CAGGTTCCAAAATGGACTGCGGG + Intronic
1127308185 15:57728421-57728443 CGGGTGCCTAAGTGCAGGGCTGG - Intronic
1128040764 15:64571333-64571355 CTGTTTGCTAAATATAGTGCTGG + Intronic
1131389793 15:92037754-92037776 CTAGTTCCTGAATGAACTGCTGG - Intronic
1131897806 15:97052952-97052974 CTGGTAACTGACTGCAGTGCGGG - Intergenic
1133253481 16:4501064-4501086 CTAGTTAGTTAATGCAGTGCGGG + Intronic
1134283532 16:12839354-12839376 CTGCTTCCAAAATGCAATGATGG - Intergenic
1136940509 16:34521281-34521303 TTGGTTGCAAAATGCAGCGCTGG + Intergenic
1136959308 16:34827289-34827311 TTGGTTGCAAAATGCAGCGCTGG - Intergenic
1136967427 16:34930612-34930634 TTGGTTGCAAAATGCAGCGCTGG - Intergenic
1139030530 16:62875648-62875670 CTGCTTCCAAAATACAGTGGTGG + Intergenic
1139594391 16:67949635-67949657 CTTGCTCCTAAATGCAGGGGTGG + Intronic
1142899546 17:3003699-3003721 CTGTTTTCTAAATGCAGCGAGGG - Intronic
1143359344 17:6355325-6355347 CTGTTTACTAAATGCTGTGCAGG + Intergenic
1146304513 17:31720625-31720647 CTTTTTCCTAAATGGAGTGGTGG + Intergenic
1150882406 17:69045430-69045452 TTCCTTCCTAAAGGCAGTGCTGG + Intronic
1151652739 17:75480239-75480261 CTGGGTCCTCACTGCAGGGCTGG + Intronic
1151940411 17:77288301-77288323 CTGGTTCCCAGGTGCAGCGCTGG - Intronic
1153699845 18:7681623-7681645 ATGGTTCCCAAATGCACTGCTGG + Intronic
1155592099 18:27439279-27439301 CTGATCCCTAAATGAAGTGTTGG - Intergenic
1156467652 18:37357934-37357956 CTACTTCCTAAATACAGTGGGGG - Intronic
1160146426 18:76369184-76369206 ATGCTTCCTAACTGCAGTGGAGG + Intronic
1161805512 19:6441061-6441083 CTGGCTCCTAAAACAAGTGCGGG - Exonic
1167688079 19:50968933-50968955 CTGGTCCCTGAGTGCAGTGAGGG + Exonic
929880851 2:45836498-45836520 CTGCTTTCCAAATGCAGAGCTGG + Intronic
931666885 2:64616042-64616064 CTGGCTCCTTAGTGCAGAGCAGG + Intergenic
932244053 2:70181505-70181527 CTCGGTCCTGAATGCAATGCAGG - Exonic
932508033 2:72255616-72255638 CTGTTTCCAAAATACAGTGGTGG - Intronic
932639753 2:73432522-73432544 CTGGTTCCAAGATCAAGTGCTGG + Intronic
932948033 2:76260378-76260400 TTCATTCCTAAATGCAATGCAGG + Intergenic
933987729 2:87606412-87606434 CTGTTGACTAAATGCAGAGCAGG + Intergenic
935532211 2:104248069-104248091 CTGCTTCCTACATGGAGTGGAGG + Intergenic
935984070 2:108655184-108655206 CTGTTTCCAAACTGCAGCGCAGG + Exonic
936136506 2:109898838-109898860 CTGTTTCCAAACTGCAGCGCAGG + Intergenic
936140190 2:109932811-109932833 CTTGTTTCAAAATACAGTGCAGG + Intergenic
936176879 2:110230756-110230778 CTTGTTTCAAAATACAGTGCAGG + Intergenic
936204506 2:110438675-110438697 CTTGTTTCAAAATACAGTGCAGG - Intronic
936208191 2:110472647-110472669 CTGTTTCCAAACTGCAGCGCAGG - Exonic
936306111 2:111344396-111344418 CTGTTGACTAAATGCAGAGCAGG - Intergenic
938266763 2:129933546-129933568 CTGGCTCCTTAAGGCTGTGCTGG + Intergenic
940195461 2:151089479-151089501 GTGGTTCCTAACAGAAGTGCAGG + Intergenic
940233294 2:151482385-151482407 CTGGTTTCTAAATCCAGAGGTGG + Intronic
940739612 2:157492494-157492516 CTGGATCCGAAATACAGTGCAGG + Intergenic
940838633 2:158553756-158553778 CTGCTTCCAAAATACAGTGGTGG - Intronic
942244544 2:173995017-173995039 CTGGTTCTGACATGCAGTGGGGG + Intergenic
944517033 2:200522545-200522567 CTGTTTCCTAAATGCTTTGATGG + Intronic
944909721 2:204298302-204298324 CTGTTTTCTAAATGCAGTCATGG - Intergenic
945267165 2:207901889-207901911 GTGGTTTCTGAAGGCAGTGCCGG + Intronic
945846279 2:214948789-214948811 CTGGTTCCCAAATGCTGGGAAGG + Intronic
945977941 2:216285175-216285197 CCTGTTCCTCAAGGCAGTGCAGG - Intronic
946978238 2:225177131-225177153 CTGGTTAATATATGCACTGCTGG + Intergenic
947080212 2:226387720-226387742 CTGGTTCTTCAATGGAGTGCTGG - Intergenic
948241886 2:236444818-236444840 CTGGATTCTAGATGCAGTGATGG + Intronic
948754140 2:240149466-240149488 CTGCTTCCTCACTGCGGTGCAGG + Intergenic
948816526 2:240513090-240513112 CTGGTCCCTGAAGGCAGTGTGGG + Intronic
1169467995 20:5858330-5858352 GTGGTTCATAAATGCACAGCAGG - Intronic
1172143942 20:32743361-32743383 CCGGGTCCTCAGTGCAGTGCAGG + Exonic
1172262855 20:33583678-33583700 ATGGTTACTAAATGCAGTGCTGG - Intronic
1172650880 20:36500514-36500536 CTGGTTCCTAAAGCTACTGCAGG + Exonic
1173552324 20:43941214-43941236 TTTTTTCTTAAATGCAGTGCAGG - Intronic
1174699222 20:52590742-52590764 CTGGTTCATAAATGAAGAGAAGG - Intergenic
1174769458 20:53284983-53285005 CTGGATCCGAATTGCAGCGCCGG - Intronic
1175844725 20:62052430-62052452 CTGGTTCCAGATGGCAGTGCTGG - Intronic
1179118567 21:38520303-38520325 CTGGTTCCTATTTGTTGTGCAGG - Intronic
1179681890 21:43028052-43028074 CTGGTGCCTACGTGCTGTGCTGG + Intronic
1182861333 22:33561898-33561920 CTTGTTCCTAAATTCATTACCGG - Intronic
1182872841 22:33663817-33663839 CAAGTTCCTGAATGCAGGGCTGG + Intronic
1185072957 22:48667241-48667263 GTGGCTCTTAGATGCAGTGCGGG - Intronic
950786921 3:15444626-15444648 CTGGTTCCTAAGTGAAGTGCTGG + Intronic
952881389 3:37988097-37988119 CTGGGACCTAAATGCAGTAAAGG + Exonic
954757308 3:52848267-52848289 CTGGCTCCCAAAGGCAGTGGTGG + Intronic
956751274 3:72345930-72345952 TTGCTTTCTGAATGCAGTGCGGG - Intergenic
957430255 3:80095497-80095519 CTGTTTCCTACATGTAGTGTAGG - Intergenic
957790710 3:84937358-84937380 CTGCTTCCAAAATGCAATGGTGG - Intergenic
958119384 3:89264220-89264242 CTGCTTCCTAAACACAATGCTGG + Intronic
959509017 3:107189075-107189097 GTGCTTCCAAAATGCAGTGGTGG + Intergenic
961447286 3:126986803-126986825 CTGGTGCCCACATGCAGTGTGGG - Intergenic
961522152 3:127473103-127473125 CTGCTTCATAACTGCAGTGCTGG - Intergenic
963146530 3:142000711-142000733 CTGTTTCCAAAATGCAATGATGG + Intronic
964186916 3:153956895-153956917 CTAGTTCCCAAATACAGTTCAGG + Intergenic
965798731 3:172468720-172468742 CTGGGTCCTAAATGATGGGCAGG + Intergenic
967252187 3:187551750-187551772 ATGCTTCCAAAATGGAGTGCTGG - Intergenic
971007923 4:22396239-22396261 CTGGTTTCTAAATTCATTTCAGG - Intronic
972172213 4:36360162-36360184 TTGGTTCCCAAAAGCAGTGTCGG - Intergenic
977559813 4:98520818-98520840 CTGCCTTCTAAAGGCAGTGCAGG - Intronic
979040215 4:115781683-115781705 CTGCTTCCTGAAAGCTGTGCGGG + Intergenic
986274921 5:6265474-6265496 CTGTGGCCTGAATGCAGTGCTGG - Intergenic
990828322 5:59927624-59927646 CTGCTTTCTGAATTCAGTGCAGG + Intronic
993487266 5:88502290-88502312 CTGGTTCATCATTGCACTGCAGG + Intergenic
994021424 5:95030105-95030127 TTGGTTCCCCACTGCAGTGCAGG - Intronic
1001646027 5:173283120-173283142 CTGGTTCCTCAAGGCAGCCCTGG + Intergenic
1004588479 6:17025971-17025993 CTGCTTCCAAGATGCAGTGCTGG - Intergenic
1005716161 6:28550296-28550318 CTGCTTCCAAAATACAGTGGTGG - Intergenic
1006077516 6:31543311-31543333 CTGGTTAGTAAATACACTGCAGG + Intronic
1008285605 6:49645831-49645853 GTGGTGACTAAATGCAGTGTAGG - Intergenic
1015326005 6:131924194-131924216 GTGGTTCTCAAATGTAGTGCTGG + Intergenic
1015789844 6:136955421-136955443 CTGGGTTCTAAATGTTGTGCTGG - Intergenic
1022507324 7:30915226-30915248 CTGGGTGCTCAATGCAGGGCTGG + Intronic
1023729477 7:43176890-43176912 CTGCTTCGTAATTGCAATGCAGG - Intronic
1023836693 7:44072832-44072854 ATGGCTCTCAAATGCAGTGCAGG + Exonic
1024414072 7:49081899-49081921 CTGCTTCCAAAATACAATGCTGG + Intergenic
1037619884 8:20554516-20554538 CTGGGTCTTGACTGCAGTGCTGG - Intergenic
1041119505 8:54571729-54571751 TTGGTTCCTAAGGGCAGTGAGGG + Intergenic
1047916572 8:129590434-129590456 CTGGCTCAAAAATGCAGTTCAGG + Intergenic
1048181719 8:132201483-132201505 CTGTTTCCAAAATGCAATGGTGG + Intronic
1049050098 8:140187942-140187964 CAGGTTCTTAAAAGCAGTGATGG + Intronic
1059437938 9:114287685-114287707 CAGGTTCCTATGTGCAGAGCGGG - Intronic
1060245333 9:121941263-121941285 CTGGCTTCTAAATGAAGTGGAGG + Intronic
1060254662 9:122016572-122016594 CTGGTTCCTAAACCCAGCGGAGG + Intronic
1062142399 9:134966864-134966886 GTGGCTGCTAAATGCAGGGCAGG - Intergenic
1186787548 X:12967854-12967876 CCGGTTCCTAACTGCACAGCAGG - Intergenic
1190699666 X:52978123-52978145 GTGGAGCCTAAATGCAATGCTGG - Intronic
1192072676 X:67957822-67957844 CTGGTTCCTAGATGTAATTCAGG - Intergenic
1192478533 X:71464876-71464898 CTAGTTCCTAAATGGATTGGAGG + Exonic
1197266437 X:124378849-124378871 ATGCTACCTAAATGCAGTGTGGG - Exonic
1198102872 X:133437094-133437116 GTGGTTCCTAAAGGCGGAGCTGG + Intergenic
1200009331 X:153109334-153109356 CTTGATCCTAAAGGCAGTGGAGG - Intergenic
1200030269 X:153290588-153290610 CTTGATCCTAAAGGCAGTGGAGG + Intergenic