ID: 1074810204

View in Genome Browser
Species Human (GRCh38)
Location 10:117096994-117097016
Sequence GTGCGCGCGCGTGCGCGCTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1074810204_1074810206 28 Left 1074810204 10:117096994-117097016 CCCAAGCGCGCACGCGCGCGCAC No data
Right 1074810206 10:117097045-117097067 ACACACACACACACACACAAAGG 0: 604
1: 3257
2: 3235
3: 4698
4: 8502

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1074810204 Original CRISPR GTGCGCGCGCGTGCGCGCTT GGG (reversed) Intronic
No off target data available for this crispr