ID: 1074815410

View in Genome Browser
Species Human (GRCh38)
Location 10:117138220-117138242
Sequence GGCCGCCGAAGCCTCCCCGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 210
Summary {0: 1, 1: 0, 2: 2, 3: 16, 4: 191}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1074815410_1074815416 -1 Left 1074815410 10:117138220-117138242 CCCGCGGGGAGGCTTCGGCGGCC 0: 1
1: 0
2: 2
3: 16
4: 191
Right 1074815416 10:117138242-117138264 CGCGCGCGGGTCAGCGGCGACGG 0: 1
1: 1
2: 0
3: 12
4: 103
1074815410_1074815417 0 Left 1074815410 10:117138220-117138242 CCCGCGGGGAGGCTTCGGCGGCC 0: 1
1: 0
2: 2
3: 16
4: 191
Right 1074815417 10:117138243-117138265 GCGCGCGGGTCAGCGGCGACGGG 0: 1
1: 0
2: 1
3: 3
4: 103
1074815410_1074815418 7 Left 1074815410 10:117138220-117138242 CCCGCGGGGAGGCTTCGGCGGCC 0: 1
1: 0
2: 2
3: 16
4: 191
Right 1074815418 10:117138250-117138272 GGTCAGCGGCGACGGGAGAGTGG 0: 1
1: 0
2: 0
3: 9
4: 154
1074815410_1074815420 26 Left 1074815410 10:117138220-117138242 CCCGCGGGGAGGCTTCGGCGGCC 0: 1
1: 0
2: 2
3: 16
4: 191
Right 1074815420 10:117138269-117138291 GTGGCGCGCTCGCCGAGAGGCGG 0: 1
1: 0
2: 0
3: 2
4: 34
1074815410_1074815414 -7 Left 1074815410 10:117138220-117138242 CCCGCGGGGAGGCTTCGGCGGCC 0: 1
1: 0
2: 2
3: 16
4: 191
Right 1074815414 10:117138236-117138258 GGCGGCCGCGCGCGGGTCAGCGG 0: 1
1: 0
2: 4
3: 30
4: 216
1074815410_1074815419 23 Left 1074815410 10:117138220-117138242 CCCGCGGGGAGGCTTCGGCGGCC 0: 1
1: 0
2: 2
3: 16
4: 191
Right 1074815419 10:117138266-117138288 AGAGTGGCGCGCTCGCCGAGAGG 0: 1
1: 0
2: 0
3: 2
4: 25

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1074815410 Original CRISPR GGCCGCCGAAGCCTCCCCGC GGG (reversed) Intronic
900204504 1:1426310-1426332 GCCCGCCGCAGCCTTCCTGCTGG + Exonic
900283870 1:1890376-1890398 GGCGGCCGGAGCCCCCGCGCGGG - Intronic
900483959 1:2912733-2912755 AGCAGCCAGAGCCTCCCCGCAGG + Intergenic
903115643 1:21176611-21176633 GGCAGCAGCAGCCGCCCCGCGGG + Intronic
903628184 1:24745852-24745874 GTCCGCCGATGCCTACGCGCTGG - Intronic
903750419 1:25617503-25617525 GCGCGCCGCAGCCTCCCCTCCGG - Exonic
903750620 1:25618147-25618169 GGCCGCCGTGGCCTCCTCGCGGG - Exonic
905308149 1:37033128-37033150 GGCCGCCCAAGGCACCCTGCAGG - Intronic
905449165 1:38046230-38046252 GGCCGCCGCCGCCGCCCCCCGGG + Exonic
905761131 1:40559023-40559045 GGCCTCAGCTGCCTCCCCGCGGG - Intergenic
908299941 1:62753649-62753671 GGCCTCAGCCGCCTCCCCGCTGG + Intergenic
915367399 1:155323759-155323781 GTCCGCCGAAGGCCCCTCGCTGG + Intronic
915441923 1:155950863-155950885 CGGCGGCGCAGCCTCCCCGCAGG - Exonic
916606037 1:166343219-166343241 GGCCTTAGATGCCTCCCCGCAGG - Intergenic
916785697 1:168085617-168085639 GGCCCCCGAAGCCGCCCCCCGGG + Exonic
918942964 1:191026137-191026159 GGCCTCAGCCGCCTCCCCGCAGG - Intergenic
921345971 1:214185502-214185524 GGCTGCAGCAGCCTCCCTGCTGG - Intergenic
922713586 1:227852747-227852769 GGCCCCCCAAGCCTCCCTTCTGG - Intergenic
923810505 1:237309769-237309791 GGCCTCAGCTGCCTCCCCGCAGG - Intronic
924313762 1:242774511-242774533 GGCCTCAGCTGCCTCCCCGCAGG - Intergenic
1064443006 10:15370737-15370759 GGCCCCCGAAGCCTCCGCCCGGG + Intronic
1067557059 10:47279743-47279765 GGCAGAGGAAGCCTCCCCCCAGG - Intergenic
1068554943 10:58448407-58448429 GGCCTCAGCTGCCTCCCCGCGGG - Intergenic
1069090792 10:64196917-64196939 GGCCCCAGCTGCCTCCCCGCAGG - Intergenic
1069698356 10:70404351-70404373 CGCCGCCGCCGCCTGCCCGCCGG + Intergenic
1073242095 10:102065690-102065712 GGCCGGCCAGCCCTCCCCGCTGG + Exonic
1074815410 10:117138220-117138242 GGCCGCCGAAGCCTCCCCGCGGG - Intronic
1076543348 10:131228148-131228170 GGCCTCCGGAGTCTCCCCTCCGG + Intronic
1080456994 11:32427375-32427397 GGCCAGAGCAGCCTCCCCGCAGG + Intronic
1084146198 11:67266579-67266601 GGGCGCCGACGCCTCCCGCCTGG - Exonic
1086034924 11:82404110-82404132 GGCCTCAGATGCCTCCCCGCGGG + Intergenic
1090230813 11:125102242-125102264 GGCCGCCGCTGCCTCCCCGCGGG - Exonic
1099315529 12:81078243-81078265 GGCCCCCGAGACCGCCCCGCGGG - Exonic
1101493960 12:105236161-105236183 GGCCGCCGCCGCCTGCCCGCCGG + Intronic
1103038328 12:117674286-117674308 GGCTGCCGCTGCCTCCTCGCTGG + Intronic
1104049457 12:125186179-125186201 GGCTCCCGGAGCCTCCCGGCCGG + Intergenic
1104373894 12:128247460-128247482 GGCCTCAGCCGCCTCCCCGCAGG + Intergenic
1108359069 13:49652689-49652711 GGCCCCAGAAGCCTCCAAGCAGG - Intergenic
1108991126 13:56659256-56659278 GGCCTCAGCTGCCTCCCCGCGGG - Intergenic
1110567681 13:76972571-76972593 GGCAGCCGAAACCTTCCTGCTGG - Intergenic
1110705921 13:78602143-78602165 GGCCGCCGCCGCCGCCCCCCGGG + Exonic
1110782382 13:79481298-79481320 GGCCGCCGAGACCTCCGCGTTGG - Exonic
1110854188 13:80278795-80278817 GGCCTCAGCTGCCTCCCCGCGGG - Intergenic
1113378632 13:109784820-109784842 GGCCGCCGCAGCCGCCGCTCAGG + Exonic
1113429971 13:110241239-110241261 GGCCGCCAAGGCCTGCCGGCTGG + Intronic
1116152103 14:41154383-41154405 GGCCTCAGCCGCCTCCCCGCGGG - Intergenic
1116441583 14:44961275-44961297 TGCCGCCCTAGCCTCCCTGCAGG - Intronic
1117297435 14:54393038-54393060 GGCGGCCCGAGCCTCCCCGATGG - Intergenic
1117539291 14:56730903-56730925 TGCTGACCAAGCCTCCCCGCAGG - Intergenic
1118992463 14:70809111-70809133 CGCCGCCGCTGCCGCCCCGCCGG - Exonic
1119382916 14:74240092-74240114 GGACGCCGAAGCATCCTCCCGGG - Intronic
1119539359 14:75428370-75428392 GGCTGCGGGAGCCTCCCCGCGGG - Intronic
1124425328 15:29558265-29558287 GGCCTCTGAAGCCACCCCACGGG + Intronic
1129458875 15:75690008-75690030 GGCCACCAATGCCTCCCTGCTGG - Exonic
1129468893 15:75739233-75739255 GGCCGCCATAGCTGCCCCGCCGG + Intergenic
1129780099 15:78264453-78264475 GGCCGCCGGAACCTCCGCGAAGG + Intronic
1130272999 15:82462079-82462101 GGCTGCCAATGCCTCCCTGCTGG + Intergenic
1130465349 15:84189438-84189460 GGCTGCCAATGCCTCCCTGCTGG + Intergenic
1130487340 15:84405370-84405392 GGCTGCCAATGCCTCCCTGCTGG - Intergenic
1130498917 15:84484098-84484120 GGCTGCCAATGCCTCCCTGCTGG - Intergenic
1130587640 15:85194045-85194067 GGCTGCCAATGCCTCCCTGCTGG + Intergenic
1132409997 15:101569423-101569445 GGCCGCATCAGCCTCCCTGCTGG + Intergenic
1132568221 16:632833-632855 GGACGCCGAGGCCTGCCTGCGGG + Exonic
1132679279 16:1133107-1133129 GGCCGCCGAGGCCTCCGCCCTGG - Intergenic
1132934580 16:2474214-2474236 GGCCGCCGCCCCGTCCCCGCCGG + Intergenic
1137617641 16:49856758-49856780 GGCCGCCGCTGCCTGCCCTCGGG + Intronic
1142474533 17:181256-181278 GGCCGCCGCAGCCCCTCCGACGG - Exonic
1142592527 17:1012605-1012627 GGCCCCCCAGCCCTCCCCGCCGG - Intronic
1142764328 17:2057104-2057126 CGCCGCCGCCGCCGCCCCGCAGG - Exonic
1146260183 17:31415818-31415840 GGTCTCCGCAGCCTCCCAGCTGG + Intronic
1147360653 17:39927563-39927585 CGCGGCTGCAGCCTCCCCGCTGG + Intronic
1148663987 17:49361592-49361614 TGCCGCCCCAGCCTCCCCTCAGG + Intronic
1151599594 17:75098054-75098076 GGCAGCCGAAGCGTCCCACCAGG - Exonic
1152748332 17:82051403-82051425 GGCCCCCGGAGGCTCCGCGCGGG - Intronic
1154241751 18:12658642-12658664 GCCCGCTGAAGCCTCCCCGCCGG + Exonic
1155611689 18:27674007-27674029 GGCCTCAGCTGCCTCCCCGCAGG - Intergenic
1156448572 18:37253995-37254017 GTCCCCCGACCCCTCCCCGCCGG - Intronic
1159289338 18:66396040-66396062 GGCCTCAGCTGCCTCCCCGCAGG + Intergenic
1160410554 18:78673033-78673055 GGCCACAGAGGCCTCCCAGCAGG + Intergenic
1160418133 18:78726333-78726355 GGCCGGTGAAGCCTCGGCGCTGG + Intergenic
1161190204 19:2950410-2950432 GGCCTCCGGAGCCTCCTCCCTGG + Intergenic
1161320581 19:3638998-3639020 GGCCGGGGAAGCCTCCACCCTGG + Exonic
1161332628 19:3695555-3695577 GGCCCCCGAGGCCTCTCCACTGG + Intronic
1162021121 19:7869071-7869093 GGACGACGTGGCCTCCCCGCAGG - Exonic
1162088357 19:8261970-8261992 GGCCGCCGCCGCCTCCTCACTGG - Exonic
1162481436 19:10929053-10929075 CTCCGCCGAAGCGTCCCTGCAGG - Exonic
1163469073 19:17486484-17486506 GGGAGCCTCAGCCTCCCCGCTGG - Intronic
1165129438 19:33622628-33622650 GCCCGACGCCGCCTCCCCGCGGG - Intronic
1165861587 19:38911994-38912016 GGCCCCTGAAGCCTCTCCACTGG + Intronic
1165995518 19:39840755-39840777 GGCCGCCAAAGCCACCCCCACGG + Exonic
924967391 2:91209-91231 GGCCTCAGCTGCCTCCCCGCGGG + Intergenic
924977437 2:191417-191439 CGCTGCCGAAGCCTCCCCAACGG - Intergenic
927596603 2:24403077-24403099 GGCCTCAGCCGCCTCCCCGCAGG + Intergenic
927942177 2:27111653-27111675 GGCCTCAGCTGCCTCCCCGCGGG - Intronic
928688576 2:33775569-33775591 GGCCTCAGCCGCCTCCCCGCGGG + Intergenic
929280458 2:40072544-40072566 GGCAGCCCAACCCTCCCCGCAGG + Intergenic
929575044 2:43046294-43046316 GGCAGCAGAAGCCTCCGAGCCGG + Intergenic
930420870 2:51151761-51151783 GGCCTCAGCTGCCTCCCCGCGGG - Intergenic
933139828 2:78779212-78779234 GGCCTCAGCCGCCTCCCCGCGGG + Intergenic
935878346 2:107536233-107536255 GGCCTCAGCTGCCTCCCCGCAGG - Intergenic
940639025 2:156329174-156329196 GTCCGCCGAAGCTGCCCTGCAGG - Intronic
940775080 2:157876290-157876312 CGCCGCCGCAGCCTCCCCCTCGG - Intergenic
942368654 2:175257145-175257167 GGCCTCAGCCGCCTCCCCGCGGG - Intergenic
943669665 2:190648398-190648420 GGTCGCTGCAGCCTTCCCGCCGG + Intronic
945664213 2:212721212-212721234 GGCCTCAGCTGCCTCCCCGCGGG - Intergenic
948838904 2:240639874-240639896 GGGCTCCGAAGTCACCCCGCCGG - Intergenic
948874341 2:240819142-240819164 GGCCGGGGCAGCATCCCCGCCGG - Intronic
1172846858 20:37934775-37934797 GGCTGCAGAAGCCTCCTCCCTGG - Intronic
1174358721 20:50015096-50015118 GGCCGCTGGAGCCCGCCCGCAGG - Intergenic
1175417013 20:58808437-58808459 GGCCGCAGAAGCCTCTCTGTGGG + Intergenic
1175946881 20:62563056-62563078 GGCCGCAGTGGCCTCCCCGTGGG + Intronic
1175975679 20:62709249-62709271 GGCCGCCGACCCCTTCCAGCGGG + Exonic
1176241116 20:64076422-64076444 GGCTTCCGAGGCATCCCCGCAGG - Intronic
1181077661 22:20392551-20392573 GGCCTTCGTTGCCTCCCCGCGGG - Intergenic
1181175239 22:21031560-21031582 GGCCGCTGTGGCCTCCCTGCTGG - Exonic
1184381199 22:44145728-44145750 GGCCGCAGAGGCCTCTCCGCCGG - Intronic
1184759590 22:46537104-46537126 GGCCGCCGCCGCCGCCCTGCCGG - Exonic
1185229102 22:49670344-49670366 GGCCTCAGCTGCCTCCCCGCGGG - Intergenic
1185231347 22:49685975-49685997 GGTGGCCAAGGCCTCCCCGCAGG + Intergenic
1185281598 22:49972170-49972192 CGCCGCAGACCCCTCCCCGCAGG - Intergenic
1185318737 22:50190546-50190568 GGCCGACGCAGCCTCCCGCCCGG + Intronic
952963381 3:38606574-38606596 GGCCCCAGCAGCCTCCCCACTGG - Intronic
953436424 3:42881089-42881111 GGCCCCCGAAGCCTCAGCGAGGG + Intronic
954156151 3:48685934-48685956 GCCCGCCGAAGCCCCGCCCCGGG + Intronic
955177360 3:56630208-56630230 GCCCGCCTCAGCCTCCCTGCTGG + Intronic
955219683 3:57013085-57013107 GGCCTCAGCTGCCTCCCCGCTGG + Intronic
956479638 3:69660884-69660906 GGCCTCAGCCGCCTCCCCGCGGG + Intergenic
960669222 3:120140467-120140489 GGCCTCAGCTGCCTCCCCGCGGG + Intergenic
961478131 3:127161313-127161335 GGCCACCGTAGTCTCCCCGCTGG + Intergenic
963554678 3:146772563-146772585 GGCCTCAGCTGCCTCCCCGCCGG + Intergenic
964064079 3:152559653-152559675 GGCCTCAGCTGCCTCCCCGCAGG + Intergenic
964129265 3:153268899-153268921 GGCCTCAGCCGCCTCCCCGCGGG + Intergenic
965728596 3:171746101-171746123 GGCCTCAGCCGCCTCCCCGCGGG + Intronic
967594904 3:191317150-191317172 GGCCTCAGCCGCCTCCCCGCGGG - Intronic
969884096 4:10200012-10200034 GTCTGCCGAAGTCTCCCTGCAGG - Intergenic
970408631 4:15786877-15786899 GGCCTCAGCTGCCTCCCCGCGGG - Intronic
970574557 4:17414429-17414451 GGCCTCAGCCGCCTCCCCGCGGG - Intergenic
970615740 4:17766949-17766971 GGCCTCAGGTGCCTCCCCGCGGG - Intronic
970617490 4:17781544-17781566 GGGCGCCGACGCCTCGCCGCAGG - Intergenic
974781726 4:66561631-66561653 GGCCTTCGCTGCCTCCCCGCGGG - Intergenic
974807549 4:66899601-66899623 GGCCTCAGCTGCCTCCCCGCAGG - Intergenic
974838217 4:67275386-67275408 GGCTTCAGCAGCCTCCCCGCAGG - Intergenic
978748583 4:112222651-112222673 GGCCTCAGCTGCCTCCCCGCAGG + Intergenic
978929780 4:114296293-114296315 GGCCTCAGCTGCCTCCCCGCTGG - Intergenic
982033697 4:151325468-151325490 CGCCGCCGACGCCTCCTCTCCGG - Intronic
982245350 4:153344969-153344991 GGCATCCGCGGCCTCCCCGCCGG + Intronic
982745717 4:159103076-159103098 GGCCGCCGGAGCCGCTCCTCAGG - Intergenic
983369749 4:166842967-166842989 GGCCTCAGCTGCCTCCCCGCGGG - Intronic
983843139 4:172481944-172481966 GGCAGCCCGAGCCTCCCCGACGG - Intronic
983939865 4:173527553-173527575 CAGCGCCGAGGCCTCCCCGCCGG - Intronic
984811367 4:183798290-183798312 GCCCGCGGGAGCCTCCCCGGTGG + Intergenic
984918122 4:184741425-184741447 GGCCTCAGCTGCCTCCCCGCAGG + Intergenic
985269322 4:188179180-188179202 GGCCTCAGCTGCCTCCCCGCAGG + Intergenic
985824738 5:2183830-2183852 GCCCCCAGCAGCCTCCCCGCAGG - Intergenic
990665700 5:58069276-58069298 GGCCTCAGCTGCCTCCCCGCAGG - Intergenic
993202197 5:84830455-84830477 GGCCTCAGCTGCCTCCCCGCGGG - Intergenic
997375523 5:133394571-133394593 GGCCTCAGCTGCCTCCCCGCAGG + Intronic
1001639130 5:173232893-173232915 CGCCGCCGCCGCCTGCCCGCAGG - Exonic
1001928740 5:175658160-175658182 CGCGGCCGCCGCCTCCCCGCGGG + Intronic
1002616468 5:180459388-180459410 GGCCTCAGCTGCCTCCCCGCGGG + Intergenic
1004693282 6:18011290-18011312 TGCCGCCGGAGCCTCCCCAACGG - Intergenic
1005117712 6:22356548-22356570 GGCCTCAGATGCCTCCCGGCGGG - Intergenic
1006342560 6:33454560-33454582 GGAAGCCGCCGCCTCCCCGCCGG - Exonic
1006396158 6:33788864-33788886 GCCCGCCGCGGCCTCTCCGCGGG - Exonic
1006496369 6:34426130-34426152 GGCCACCCCAGGCTCCCCGCGGG - Intergenic
1007273790 6:40658675-40658697 GGCTGTAGAAGCCTCCCCCCAGG + Intergenic
1018109385 6:160520407-160520429 GGCCTCAGCCGCCTCCCCGCAGG - Intergenic
1018619470 6:165715976-165715998 GCCCACGGAAGCCTCCCCTCCGG + Intronic
1019198363 6:170295614-170295636 CGGCTCCTAAGCCTCCCCGCTGG + Intronic
1019614318 7:1952301-1952323 GGCCGACTCAGCCTCCCCGGCGG + Intronic
1019911425 7:4102637-4102659 GGCCACCAGAGCCTCCCAGCAGG + Intronic
1019928798 7:4210085-4210107 GGCCGCCGCAGGCTCGCCCCAGG - Exonic
1020211581 7:6162305-6162327 AGTCGCCGCCGCCTCCCCGCGGG + Exonic
1022739719 7:33109403-33109425 CGCCGCCGGAGCCGCGCCGCGGG - Intergenic
1029124025 7:98285233-98285255 GGCCGTGGCAGCCTCCACGCTGG - Intronic
1032125216 7:129188678-129188700 GCCCCCCGAACTCTCCCCGCCGG - Intergenic
1032298805 7:130668426-130668448 GGGCGCCGGAGCCTCCCTTCGGG - Intronic
1032339666 7:131058982-131059004 GGCCTCAGCTGCCTCCCCGCGGG + Intergenic
1035265588 7:157688965-157688987 GGCCGCAGCACCCTCCGCGCCGG - Intronic
1035282968 7:157788773-157788795 GGCCCCAGAAGCCTCCCCTATGG - Intronic
1035463882 7:159063280-159063302 GGCCTCAGCTGCCTCCCCGCAGG - Intronic
1036135075 8:6152926-6152948 GGCCTCAGCTGCCTCCCCGCAGG + Intergenic
1037566901 8:20125681-20125703 GGCTAAGGAAGCCTCCCCGCTGG - Intergenic
1040501441 8:48008628-48008650 GGCCGCCGGGGCCTCGGCGCCGG - Intronic
1040701828 8:50075166-50075188 GGCAGCCGGAGCCTCCCCAATGG + Intronic
1040794191 8:51271458-51271480 GGCCTCAGCTGCCTCCCCGCAGG + Intergenic
1041068548 8:54104412-54104434 GGCCTCAGCCGCCTCCCCGCGGG + Intergenic
1042948743 8:74179671-74179693 GGCCTCAGCTGCCTCCCCGCAGG - Intergenic
1043148460 8:76683102-76683124 GCCCGCAGAAGCCTCCTCTCTGG - Intronic
1044459635 8:92429373-92429395 GGCCTCAGCTGCCTCCCCGCAGG - Intergenic
1044931087 8:97252199-97252221 GGCAGTCGAAGCCTCCACGTGGG + Intergenic
1045459275 8:102412371-102412393 GGCCGCCGCCGCCTCCCTGCCGG + Exonic
1048112869 8:131487248-131487270 GGCCTCAGCTGCCTCCCCGCAGG + Intergenic
1048214113 8:132480425-132480447 GGCCGCCGCCGCGTCCCCTCCGG + Exonic
1049207348 8:141369713-141369735 GGCTGCTGATGCCTCACCGCTGG - Intergenic
1049338499 8:142099291-142099313 GGCCGTCTATGCCTCCCAGCGGG - Intergenic
1049354943 8:142182884-142182906 GGCCTCTGAAGCCTCCCAGCTGG - Intergenic
1049766703 8:144358423-144358445 GGCTGCCCCAGCCTCCCGGCAGG - Exonic
1049783546 8:144439836-144439858 GGCCGCCCCAGGCTCCCTGCGGG + Intronic
1051929039 9:22363614-22363636 GGCCTCAGCCGCCTCCCCGCGGG - Intergenic
1056434265 9:86560015-86560037 GACCGCAGCAGCTTCCCCGCCGG - Intergenic
1056659801 9:88535359-88535381 GCTCGCCGCCGCCTCCCCGCAGG + Exonic
1056677231 9:88686057-88686079 GGCCGCAGCTGCCTCCCCGCGGG - Intergenic
1059119727 9:111631294-111631316 AGCAGCCGACGCCTCCGCGCAGG - Intergenic
1062323748 9:136003048-136003070 GGCTGCTGGAGCCTCCCAGCTGG + Intergenic
1194977889 X:100411275-100411297 GGGCGCCCCAGCCTTCCCGCGGG + Intergenic
1200091867 X:153639791-153639813 GGCCGTCAAAGCCTCACAGCTGG - Intergenic
1200119605 X:153784084-153784106 GGCGGCCGTAGCCTCAGCGCGGG + Exonic
1202369883 Y:24189264-24189286 GGCCGCCAATGCCTCCCTGCTGG - Intergenic
1202500901 Y:25480853-25480875 GGCCGCCAATGCCTCCCTGCTGG + Intergenic