ID: 1074826880

View in Genome Browser
Species Human (GRCh38)
Location 10:117221090-117221112
Sequence GGCAGGAGGGGCGCTTGCTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1074826880_1074826884 -9 Left 1074826880 10:117221090-117221112 CCAAAGCAAGCGCCCCTCCTGCC No data
Right 1074826884 10:117221104-117221126 CCTCCTGCCATCTCCGTGAGTGG No data
1074826880_1074826888 13 Left 1074826880 10:117221090-117221112 CCAAAGCAAGCGCCCCTCCTGCC No data
Right 1074826888 10:117221126-117221148 GCAGCTCCAGCAGCCCCACCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1074826880 Original CRISPR GGCAGGAGGGGCGCTTGCTT TGG (reversed) Intergenic