ID: 1074827343

View in Genome Browser
Species Human (GRCh38)
Location 10:117223943-117223965
Sequence CAGTGTTAGTTCCACGAGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1074827335_1074827343 17 Left 1074827335 10:117223903-117223925 CCAGCTCTAATTGCATGTCGATT No data
Right 1074827343 10:117223943-117223965 CAGTGTTAGTTCCACGAGGCAGG No data
1074827336_1074827343 -10 Left 1074827336 10:117223930-117223952 CCCAGCCCCCATGCAGTGTTAGT No data
Right 1074827343 10:117223943-117223965 CAGTGTTAGTTCCACGAGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1074827343 Original CRISPR CAGTGTTAGTTCCACGAGGC AGG Intergenic
No off target data available for this crispr