ID: 1074829992

View in Genome Browser
Species Human (GRCh38)
Location 10:117241333-117241355
Sequence CCCCGGGGCAGCCGGGGCGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 543
Summary {0: 1, 1: 0, 2: 5, 3: 40, 4: 497}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1074829979_1074829992 8 Left 1074829979 10:117241302-117241324 CCCCAGAGCTACGCGGGCGGGGC 0: 1
1: 0
2: 0
3: 9
4: 66
Right 1074829992 10:117241333-117241355 CCCCGGGGCAGCCGGGGCGCAGG 0: 1
1: 0
2: 5
3: 40
4: 497
1074829981_1074829992 6 Left 1074829981 10:117241304-117241326 CCAGAGCTACGCGGGCGGGGCTG 0: 1
1: 0
2: 0
3: 4
4: 114
Right 1074829992 10:117241333-117241355 CCCCGGGGCAGCCGGGGCGCAGG 0: 1
1: 0
2: 5
3: 40
4: 497
1074829980_1074829992 7 Left 1074829980 10:117241303-117241325 CCCAGAGCTACGCGGGCGGGGCT 0: 1
1: 0
2: 0
3: 6
4: 54
Right 1074829992 10:117241333-117241355 CCCCGGGGCAGCCGGGGCGCAGG 0: 1
1: 0
2: 5
3: 40
4: 497
1074829977_1074829992 9 Left 1074829977 10:117241301-117241323 CCCCCAGAGCTACGCGGGCGGGG 0: 1
1: 0
2: 1
3: 2
4: 60
Right 1074829992 10:117241333-117241355 CCCCGGGGCAGCCGGGGCGCAGG 0: 1
1: 0
2: 5
3: 40
4: 497

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1074829992 Original CRISPR CCCCGGGGCAGCCGGGGCGC AGG Intronic