ID: 1074831735

View in Genome Browser
Species Human (GRCh38)
Location 10:117254395-117254417
Sequence AGCATGCCCATCCCTACACA GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 150
Summary {0: 1, 1: 0, 2: 3, 3: 8, 4: 138}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1074831735_1074831740 22 Left 1074831735 10:117254395-117254417 CCCTGTGTAGGGATGGGCATGCT 0: 1
1: 0
2: 3
3: 8
4: 138
Right 1074831740 10:117254440-117254462 GAAGAGAGAGGCAACGTCATGGG 0: 1
1: 0
2: 1
3: 14
4: 188
1074831735_1074831739 21 Left 1074831735 10:117254395-117254417 CCCTGTGTAGGGATGGGCATGCT 0: 1
1: 0
2: 3
3: 8
4: 138
Right 1074831739 10:117254439-117254461 TGAAGAGAGAGGCAACGTCATGG 0: 1
1: 0
2: 0
3: 27
4: 192
1074831735_1074831738 10 Left 1074831735 10:117254395-117254417 CCCTGTGTAGGGATGGGCATGCT 0: 1
1: 0
2: 3
3: 8
4: 138
Right 1074831738 10:117254428-117254450 TACACAGATGATGAAGAGAGAGG 0: 1
1: 0
2: 2
3: 41
4: 402

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1074831735 Original CRISPR AGCATGCCCATCCCTACACA GGG (reversed) Exonic
903362092 1:22783290-22783312 AGGGTGCCCATCCCCAGACATGG + Intronic
907647836 1:56261958-56261980 AGTATGACCAACCCTTCACAAGG + Intergenic
909096609 1:71295826-71295848 AGCATGCTCATCCCTGCCCATGG - Intergenic
912775936 1:112506588-112506610 CCCAGCCCCATCCCTACACAGGG - Intronic
913379367 1:118191889-118191911 AGCATTCCCATCCCTCTAAATGG - Intergenic
913488611 1:119357282-119357304 ACCATGCCCATCCCTTAACCAGG + Intergenic
913491413 1:119383362-119383384 AGCATCCCTTTCCCTACAGATGG - Intronic
915307651 1:154989872-154989894 GGCCTGCACATCCATACACAAGG - Intronic
918306572 1:183252180-183252202 AGCATGCCCTTTACTACAAAGGG - Exonic
918494220 1:185115318-185115340 AGGATGCCCATCCCTTGGCAGGG - Intergenic
920397423 1:205657563-205657585 ATCATGCCCATCCCTACTCAGGG + Intergenic
921219933 1:212966176-212966198 AGCATGCCTGTCCCCACACCAGG - Intronic
921259501 1:213373169-213373191 AGCATGCCCATTTTTACAGATGG + Intergenic
922543108 1:226433828-226433850 AGCATGTCCAGCACTACACAAGG + Intergenic
924647738 1:245894716-245894738 ACCATCCCCAGCCCAACACATGG - Intronic
1063521365 10:6744294-6744316 AGAATGCCCATCATTCCACAGGG - Intergenic
1064018202 10:11788807-11788829 ATCATGCCCAGCCCTCCTCAAGG + Intergenic
1065089274 10:22213973-22213995 AGCATGCCTATTCCTGCACCAGG - Intergenic
1066656921 10:37705078-37705100 AGCCAGCCAAGCCCTACACAAGG - Intergenic
1067723404 10:48747932-48747954 GGCATTCCCATACCTACAGAAGG - Intronic
1072639956 10:97204404-97204426 AGTTTGCCCATCCTTAAACAAGG + Intronic
1074831735 10:117254395-117254417 AGCATGCCCATCCCTACACAGGG - Exonic
1075345723 10:121680779-121680801 AGCCTGCCCATCCCAGCACTCGG + Intergenic
1075687589 10:124375341-124375363 AGCATGCTCATCACCACAGAAGG + Intergenic
1077974195 11:7229866-7229888 AGCATTCCCATTCATAAACATGG + Intergenic
1079377106 11:19903290-19903312 AGCATGACCATTCGTCCACAGGG - Intronic
1082835130 11:57645930-57645952 CGCATGCCCCTCCCTCCCCACGG - Exonic
1084674042 11:70624045-70624067 AGGCTGCCCCTCCCTGCACAGGG - Intronic
1085174626 11:74475083-74475105 AGCATGTCCAGCCTGACACATGG + Intergenic
1088982860 11:114879295-114879317 AGCATGCTCCTTACTACACAAGG + Intergenic
1095244015 12:39897535-39897557 AACATTTCCATCCCCACACAGGG - Intronic
1096874414 12:54615953-54615975 AGCCTGTACATCCCTAAACAAGG - Intergenic
1101895869 12:108756134-108756156 ACCATGCCCAGCCCTTTACATGG - Intergenic
1104866423 12:131958284-131958306 AGCATGCCCCTCCCACCACCCGG - Intronic
1105563578 13:21519692-21519714 TGAATGGCCATCCCTACAGATGG - Intronic
1105613652 13:21992127-21992149 AGCATATCCATCCCTTCAAACGG + Intergenic
1111452165 13:88433744-88433766 AGCAGGACCCTCCCTACATAAGG + Intergenic
1111824567 13:93251239-93251261 AGCAAACCCATCCCTGCCCAAGG - Intronic
1114338688 14:21720114-21720136 AACATGCACATCACAACACAAGG - Intergenic
1114822491 14:26038423-26038445 AGCATTTCCATCCATACACCAGG + Intergenic
1117101192 14:52349967-52349989 AGAATGCCCAAGCTTACACATGG - Intergenic
1120135734 14:80866202-80866224 ACCAGGCCCATCCCAACACCAGG + Intronic
1121509301 14:94500535-94500557 CACATGCCCCTCCCTAAACAAGG - Intronic
1122154492 14:99742132-99742154 GGCAGGCCCAGCCCTTCACAGGG - Intronic
1122305129 14:100760408-100760430 AGCATGCCCACTCTTACACCAGG - Intergenic
1123439266 15:20278878-20278900 AGCCTTCCCATCCGTAAACATGG - Intergenic
1123834622 15:24176838-24176860 ATTATCCCCATTCCTACACAGGG + Intergenic
1123870340 15:24565687-24565709 ATTATCCCCATTCCTACACAGGG + Intergenic
1125261490 15:37830833-37830855 AGGAGGCACATCCTTACACAGGG - Intergenic
1127839351 15:62817560-62817582 ACCATGACCAGCCCTAGACACGG - Intronic
1129232492 15:74204472-74204494 AGCAAGCCCTTCCCTGCTCAGGG + Intronic
1131553791 15:93379623-93379645 ACCATGCCCAGCCCTAGCCATGG - Intergenic
1133883327 16:9803664-9803686 AGTATGCCCATCCCTGCACAAGG - Intronic
1135616327 16:23913950-23913972 AGCATTCCCACCCCTACAACAGG - Intronic
1136845907 16:33575502-33575524 AGCCTTCCCATCCGTAAACATGG + Intergenic
1137767951 16:50992296-50992318 AGTATGCCCATCCCTATATGAGG + Intergenic
1138656442 16:58494350-58494372 AGCTTCCCCATCCCTACAAGTGG + Intronic
1140022229 16:71249344-71249366 AACATGCCCATTTCTACAAAAGG - Intergenic
1141205391 16:81929295-81929317 AGCATGCCCGTGCCTGCCCAGGG - Intronic
1203107615 16_KI270728v1_random:1424155-1424177 AGCCTTCCCATCCGTAAACATGG + Intergenic
1145034077 17:19528052-19528074 TGCATGTCCATTCCTACATAGGG + Intronic
1146195017 17:30804308-30804330 AACATGTCCATCTCTTCACATGG + Intronic
1147563455 17:41522580-41522602 AGCAGGGCCATACCTACCCAAGG + Intergenic
1148190740 17:45676971-45676993 AGCATTCCCTTCCCTCCAGAAGG - Intergenic
1148868426 17:50641364-50641386 AGGATGACGATCCCTACTCAAGG - Intronic
1151750869 17:76036812-76036834 AGCTTGCACATCCCTTCACATGG - Intergenic
1154210128 18:12372528-12372550 AGCAATGCCATCCCTACCCAAGG + Intronic
1161317972 19:3627088-3627110 GGCAGGCCCCTCCCTGCACAAGG - Intergenic
1161998569 19:7729701-7729723 AGCCTGCCCATCCCTAAGTATGG + Intronic
1162007657 19:7790269-7790291 AGCCTGCCCATCCCTAAGCATGG - Intergenic
1165759961 19:38315338-38315360 AACATCTCCATCCCAACACAGGG + Intronic
925841879 2:7999722-7999744 GGCATGCCCCTCCCTGCACTGGG - Intergenic
925974970 2:9136059-9136081 AGCCTGCCCATCCCAGTACAGGG + Intergenic
926424825 2:12731277-12731299 AGCACAGCCCTCCCTACACACGG - Intronic
928429224 2:31204250-31204272 AACATACCCATCCCTTCTCATGG + Intronic
929533533 2:42766939-42766961 AGAATGCCCATCCACAAACAGGG + Intergenic
932840266 2:75075268-75075290 AGCATGTCCATACCAACACCTGG - Intronic
933808034 2:86014248-86014270 ACCAGGCCCATCCCTTCCCATGG - Intergenic
936031860 2:109079005-109079027 AACATATCCATCCCTTCACATGG - Intergenic
938264605 2:129918125-129918147 AGCATACACATTCTTACACAAGG + Intergenic
943428126 2:187762075-187762097 TGCATGCACATCCACACACAAGG - Intergenic
945907334 2:215609872-215609894 AGCATGGCCATGCCAACACCTGG - Intergenic
946176529 2:217925450-217925472 AGCTTGCCCAGCCCTCCAAAGGG + Intronic
947584520 2:231345439-231345461 AACATTCCAATCCCAACACAGGG - Intronic
948542728 2:238701900-238701922 AGCATGCCAATGCTTACACAAGG - Intergenic
1169060905 20:2659792-2659814 AGCCTGCCCCTCTCTCCACAGGG - Exonic
1169478625 20:5956204-5956226 AGAATCCCCTTCCCTTCACATGG + Intronic
1172088797 20:32411825-32411847 ATTATGCCCAGCCCTACCCATGG + Intronic
1179808469 21:43854966-43854988 AGCATGGCCACCCCTCCCCATGG + Intergenic
1180220906 21:46357263-46357285 AGGATGCCCCTCCATACACAAGG - Intronic
1180597389 22:16987397-16987419 AGCATGTCCATCACCACAGATGG - Intronic
1181090053 22:20466479-20466501 ACCATCCCCATCCCTACCCTAGG + Intronic
1181689415 22:24550169-24550191 AGTCTGGCCATCCCTAAACAGGG + Intronic
1183573663 22:38673078-38673100 AGCAAGGCCGGCCCTACACACGG - Intronic
1183674538 22:39292123-39292145 AGCCTGCCCACCCCGCCACACGG - Intergenic
1184757388 22:46524790-46524812 AAAATGCCCATCCCTTCACCAGG + Intronic
1185141891 22:49107112-49107134 AACATGCCCAGCACTAAACAGGG - Intergenic
950571225 3:13801263-13801285 AGCATGCCCTGCCCTCCACCTGG + Intergenic
953438352 3:42897501-42897523 AGCCTTCCCCTCCCTACCCAGGG + Intronic
953915998 3:46921603-46921625 AACATGCCCAGCCCAACACAGGG + Intergenic
954289366 3:49641442-49641464 CACGTGCCCATCCCTGCACAGGG + Intronic
958572961 3:95911683-95911705 AGCCTGCCCATGGCTGCACATGG - Intergenic
959738218 3:109685403-109685425 ACCATGCCCATGCCCACAAAAGG - Intergenic
960061883 3:113331161-113331183 ATCATGGCCTTGCCTACACAAGG - Intronic
962978145 3:140464037-140464059 AGCAGGGCCATCCTTACAGAGGG + Intronic
963108308 3:141665009-141665031 TGCATGCTGATACCTACACATGG - Intergenic
963359366 3:144250858-144250880 CTCATTCCCATCCCTTCACAGGG - Intergenic
964362091 3:155908970-155908992 ATCTTGCCCACCTCTACACATGG - Intronic
964894227 3:161575446-161575468 ACCATGCACATCCCTTCTCAGGG + Intergenic
966336429 3:178873055-178873077 ATCATTCTCATCCCTACAAAGGG + Intergenic
968496377 4:919528-919550 AGCAGGCCCATTCCTGCCCAGGG + Intronic
972131100 4:35834314-35834336 ACCATGCCCAGCCCTTCACTAGG + Intergenic
975134055 4:70857119-70857141 ACCATGCCCAGCCCTCCATAGGG - Intergenic
976049231 4:80991585-80991607 GGCATGTCCATCCATAGACATGG + Intergenic
978355658 4:107870008-107870030 ATCATGGACATTCCTACACAAGG - Intronic
984291391 4:177799503-177799525 AGCATGTGAAACCCTACACAAGG + Intronic
996379818 5:122851625-122851647 AGCATGCTCTTCAGTACACAAGG + Intronic
1000082909 5:157864358-157864380 AGCATGCCCATTCTCACAGAAGG - Intergenic
1006807893 6:36800330-36800352 AGCAGGCCCTTCCCTTCACCTGG + Intronic
1006919880 6:37620398-37620420 ACTATGCCCATCCCCACACCTGG + Intergenic
1006986350 6:38178269-38178291 AGCTTGCCCACCCCCACCCATGG - Intronic
1007605695 6:43116294-43116316 AGCCTGGCCATCCCTTCTCACGG - Intronic
1007639236 6:43323976-43323998 AGTATTCTGATCCCTACACATGG - Intronic
1008219170 6:48834861-48834883 AGTATGCCCAGCCTTAAACAAGG - Intergenic
1008374721 6:50778586-50778608 AGCAAGCACACCCCTACCCATGG + Intergenic
1010350353 6:74866729-74866751 AGCATGGTCTTCCCTACAAATGG + Intergenic
1016876875 6:148874037-148874059 AGCAGCCCCAGCCCTGCACATGG - Intronic
1017132789 6:151122391-151122413 ATCATGGACATCCCTACAGAAGG - Intergenic
1018648894 6:165974439-165974461 AGCATGGCCATCCCCACAAGGGG - Intronic
1023394883 7:39743525-39743547 AGCATCCCCTTCCCCACACTGGG - Intergenic
1035270045 7:157714380-157714402 CGCAAGCCCAGCCCTGCACAGGG - Intronic
1035765546 8:2102019-2102041 AGCAGGCCCACCCCACCACAGGG - Intronic
1036657825 8:10689136-10689158 ACCAATCCCTTCCCTACACAGGG + Intronic
1037620101 8:20556018-20556040 AGCAGGTCCATTCCAACACATGG - Intergenic
1039172141 8:34759821-34759843 AGCATTCCAGTGCCTACACAAGG + Intergenic
1043952170 8:86321478-86321500 AGCTTGCCTAATCCTACACAGGG + Intergenic
1045150035 8:99395389-99395411 ATGATTCCCATCCTTACACAGGG + Intronic
1047178934 8:122568697-122568719 TCCATGCCCATCCCTGCCCAGGG - Intergenic
1048793290 8:138124248-138124270 AGCATGCCCATGCTTAGACTTGG - Intergenic
1049123217 8:140759128-140759150 AGTATCCCCATCTTTACACACGG + Intronic
1051889055 9:21924722-21924744 AGCCTTCCCTTCCCTACCCAGGG + Intronic
1052857959 9:33418630-33418652 AGGCCTCCCATCCCTACACAGGG + Intergenic
1060860712 9:126952502-126952524 AGCATGGCCATCCTTACACAAGG + Intronic
1060972856 9:127748766-127748788 AGCATGCAAATCACTGCACAGGG - Intronic
1061390028 9:130312396-130312418 ACAATGCCCATCACAACACAAGG - Intronic
1062124593 9:134853232-134853254 AGCATCCCCATCCTTGCCCAGGG + Intergenic
1192194873 X:69021471-69021493 AGCCTGTCCATCCCTGAACAGGG + Intergenic
1193286766 X:79723385-79723407 AGCCTTCCCCTCCCTACCCAGGG + Intergenic
1194524802 X:94966278-94966300 AGCCTTCCCATCCCTACCCAGGG + Intergenic
1194534374 X:95087113-95087135 AGCAAACACATCCCTCCACATGG + Intergenic