ID: 1074831919

View in Genome Browser
Species Human (GRCh38)
Location 10:117255302-117255324
Sequence CTATGAGTTTGTGGGGAAGA CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 347
Summary {0: 1, 1: 0, 2: 2, 3: 35, 4: 309}

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1074831901_1074831919 23 Left 1074831901 10:117255256-117255278 CCCCACTTTCTCTCCCTGCAGTG 0: 1
1: 0
2: 7
3: 74
4: 555
Right 1074831919 10:117255302-117255324 CTATGAGTTTGTGGGGAAGACGG 0: 1
1: 0
2: 2
3: 35
4: 309
1074831904_1074831919 21 Left 1074831904 10:117255258-117255280 CCACTTTCTCTCCCTGCAGTGGG 0: 1
1: 0
2: 4
3: 47
4: 456
Right 1074831919 10:117255302-117255324 CTATGAGTTTGTGGGGAAGACGG 0: 1
1: 0
2: 2
3: 35
4: 309
1074831914_1074831919 -6 Left 1074831914 10:117255285-117255307 CCCTTCGGGAGTGTGCTCTATGA 0: 1
1: 0
2: 0
3: 3
4: 44
Right 1074831919 10:117255302-117255324 CTATGAGTTTGTGGGGAAGACGG 0: 1
1: 0
2: 2
3: 35
4: 309
1074831915_1074831919 -7 Left 1074831915 10:117255286-117255308 CCTTCGGGAGTGTGCTCTATGAG 0: 1
1: 0
2: 0
3: 2
4: 50
Right 1074831919 10:117255302-117255324 CTATGAGTTTGTGGGGAAGACGG 0: 1
1: 0
2: 2
3: 35
4: 309
1074831913_1074831919 -5 Left 1074831913 10:117255284-117255306 CCCCTTCGGGAGTGTGCTCTATG 0: 1
1: 0
2: 0
3: 2
4: 49
Right 1074831919 10:117255302-117255324 CTATGAGTTTGTGGGGAAGACGG 0: 1
1: 0
2: 2
3: 35
4: 309
1074831911_1074831919 -3 Left 1074831911 10:117255282-117255304 CCCCCCTTCGGGAGTGTGCTCTA 0: 1
1: 0
2: 0
3: 3
4: 53
Right 1074831919 10:117255302-117255324 CTATGAGTTTGTGGGGAAGACGG 0: 1
1: 0
2: 2
3: 35
4: 309
1074831906_1074831919 10 Left 1074831906 10:117255269-117255291 CCCTGCAGTGGGCCCCCCCTTCG 0: 1
1: 0
2: 0
3: 11
4: 90
Right 1074831919 10:117255302-117255324 CTATGAGTTTGTGGGGAAGACGG 0: 1
1: 0
2: 2
3: 35
4: 309
1074831907_1074831919 9 Left 1074831907 10:117255270-117255292 CCTGCAGTGGGCCCCCCCTTCGG 0: 1
1: 0
2: 0
3: 8
4: 128
Right 1074831919 10:117255302-117255324 CTATGAGTTTGTGGGGAAGACGG 0: 1
1: 0
2: 2
3: 35
4: 309
1074831912_1074831919 -4 Left 1074831912 10:117255283-117255305 CCCCCTTCGGGAGTGTGCTCTAT 0: 1
1: 0
2: 0
3: 3
4: 42
Right 1074831919 10:117255302-117255324 CTATGAGTTTGTGGGGAAGACGG 0: 1
1: 0
2: 2
3: 35
4: 309
1074831902_1074831919 22 Left 1074831902 10:117255257-117255279 CCCACTTTCTCTCCCTGCAGTGG 0: 1
1: 0
2: 1
3: 43
4: 330
Right 1074831919 10:117255302-117255324 CTATGAGTTTGTGGGGAAGACGG 0: 1
1: 0
2: 2
3: 35
4: 309
1074831910_1074831919 -2 Left 1074831910 10:117255281-117255303 CCCCCCCTTCGGGAGTGTGCTCT 0: 1
1: 0
2: 1
3: 4
4: 97
Right 1074831919 10:117255302-117255324 CTATGAGTTTGTGGGGAAGACGG 0: 1
1: 0
2: 2
3: 35
4: 309

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1074831919 Original CRISPR CTATGAGTTTGTGGGGAAGA CGG Exonic
903556913 1:24200694-24200716 CTTTTACTTAGTGGGGAAGATGG + Intergenic
903618951 1:24683825-24683847 GCATGGGGTTGTGGGGAAGAGGG + Intergenic
904320324 1:29693770-29693792 CTATGACATTCTGGGGAAAAAGG - Intergenic
906346034 1:45014937-45014959 CAGGGAGTGTGTGGGGAAGACGG + Exonic
906471445 1:46133917-46133939 GAATGAGTATGTGAGGAAGAGGG - Intronic
907331251 1:53673046-53673068 GCATGAGATTGTGGGGAACACGG - Intronic
907392819 1:54169390-54169412 GTTTGAGTTTATGAGGAAGAGGG + Intronic
907539096 1:55196051-55196073 ATATGAGGCTGTGGTGAAGAAGG - Intronic
907935718 1:59040459-59040481 CTATGAATTTTTGGGGTGGAGGG + Intergenic
907935880 1:59041918-59041940 GTGTGACTTTGTGGGGAAGAGGG + Intergenic
912490235 1:110058773-110058795 TTCTGACTTGGTGGGGAAGAAGG + Intronic
912812948 1:112807530-112807552 CAATGACTTGGTGGGGAAGAGGG + Intergenic
913614526 1:120544862-120544884 ATAAAAGTTTGAGGGGAAGATGG - Intergenic
914422476 1:147541875-147541897 CTCTGGGTTGGTGGGGGAGAAGG + Intronic
914575745 1:148966039-148966061 ATAAAAGTTTGAGGGGAAGATGG + Intronic
914860772 1:151384067-151384089 CTATGTGTTTGCTGTGAAGATGG - Intergenic
915910217 1:159910349-159910371 CTATGGGAATGTGGGGAAGGGGG - Intergenic
916335949 1:163671463-163671485 TTATTAGTTTGTGGTGAGGATGG - Intergenic
916697006 1:167248578-167248600 CCAGTAGTTTGTGGGGAGGAGGG + Intronic
917108619 1:171521322-171521344 CTATGATTTTGAAGGGAAGAAGG - Intronic
917186479 1:172362294-172362316 CTATGAGTGTCTAGGAAAGAGGG + Intronic
917348003 1:174048899-174048921 CTGTGAGTTAGGGGAGAAGATGG - Intergenic
918001504 1:180501978-180502000 CTATCAGTTGTTGAGGAAGAAGG + Intronic
919300760 1:195762501-195762523 CTATGTGTTAGTGTAGAAGAAGG + Intergenic
920730959 1:208483984-208484006 CCATGAGTTTCTGGAGAACAGGG - Intergenic
922428668 1:225525255-225525277 GTATGAGTTTATTGGGAAAATGG - Intronic
922718754 1:227889736-227889758 TGATGAGGGTGTGGGGAAGAAGG + Intergenic
923465293 1:234243002-234243024 CTATGAATTAGTGGGGGAGTAGG + Intronic
924157462 1:241193825-241193847 ATCTGAGTTTCTGGGAAAGAAGG - Intronic
1062840398 10:666102-666124 CTGTGAGTTCGTGGGAAAGAAGG + Intronic
1063369641 10:5512735-5512757 CTATGAATTTGAGGGGTACACGG - Intergenic
1065513227 10:26500311-26500333 CTGTGACTTTGGGGTGAAGACGG - Intronic
1065980963 10:30896644-30896666 ATATGGGGTTGTGGGGAGGAGGG + Intronic
1069171044 10:65229640-65229662 CTATGAGTTTGTGAAGAAAAGGG + Intergenic
1069242913 10:66164541-66164563 CTATGTGTCTGAGGGGAAGAGGG - Intronic
1070887132 10:79911600-79911622 TTATGAGATTTTGGGGAACAGGG + Intergenic
1071385268 10:85113238-85113260 CTGTGAGGTTGTGGGAAAGGAGG - Intergenic
1071393062 10:85194850-85194872 CTATGAGTTGCTGGGGAGGATGG + Intergenic
1071944400 10:90625693-90625715 CTATGCATTTGTGGGACAGATGG + Intergenic
1072606502 10:96988040-96988062 CTCTGAGTTTCTGGAGAAGCTGG + Intergenic
1072899361 10:99393752-99393774 CTCTGGGTTGTTGGGGAAGAGGG - Exonic
1073066394 10:100761944-100761966 ATGTGAGTTGGTGGGGAAGGAGG - Intronic
1073551035 10:104401582-104401604 CTACAAGTCTGTGGGGAATAAGG - Intronic
1074624271 10:115162736-115162758 CTAAGAGGTTGTGGGGAACAGGG + Intronic
1074724875 10:116297633-116297655 CTGTGTGTTTGTGGAGAGGACGG + Intergenic
1074760211 10:116661817-116661839 GTATGAGTTTGTGTGTATGAGGG + Intergenic
1074831919 10:117255302-117255324 CTATGAGTTTGTGGGGAAGACGG + Exonic
1076436260 10:130444740-130444762 ACATGAGTAAGTGGGGAAGATGG - Intergenic
1076689341 10:132213336-132213358 CTGTGGGTGTGTTGGGAAGATGG - Intronic
1078454986 11:11467944-11467966 CTAAGAGATTCTAGGGAAGAAGG + Intronic
1079101204 11:17543456-17543478 CTAAGACTTGGTGGGGAAGTAGG + Intronic
1080389689 11:31833636-31833658 CTGTGGGTTTGAGGTGAAGAGGG + Intronic
1080663923 11:34319221-34319243 CGGTGGGGTTGTGGGGAAGAAGG - Intronic
1080846325 11:36030172-36030194 GTCTGAGTTTGGGGCGAAGATGG - Intronic
1081215531 11:40392122-40392144 CTAGGGGTTTGTGGGGATGAGGG + Intronic
1081513530 11:43801264-43801286 ATATGAGTATGTGGGGGACAGGG + Intronic
1084351237 11:68601309-68601331 CTCTGAGTTTGTGGGAATGAGGG + Intronic
1085996226 11:81917587-81917609 ATAGAAGTTTGTGGGGAGGAAGG + Intergenic
1087268241 11:96084129-96084151 ATATGAGTTTGGGGAGAGGATGG + Intronic
1087770047 11:102199022-102199044 CTATGTGTTTGTGGAGGAGAAGG + Intronic
1088245531 11:107814490-107814512 CCAGGAGTTTGTGGGGAGGGAGG + Intronic
1089395105 11:118131587-118131609 CTCTCAGATTGTGGGGAAGGTGG - Intergenic
1090219454 11:125005464-125005486 CTACGCATTTGTGGGGCAGAGGG - Intronic
1092320580 12:7469690-7469712 TGATGAGGTTGTGGGGAAAAGGG + Intronic
1093668722 12:21846540-21846562 ATATCAGGTTGTGGGGAGGAAGG + Intronic
1096768500 12:53914881-53914903 CTATGCGTGTGTGGGGCAGGGGG - Intergenic
1097497021 12:60352704-60352726 CTATTAAATTGTGGGGCAGAGGG - Intergenic
1097512334 12:60559335-60559357 TGATGAGGTTGTGGAGAAGAGGG - Intergenic
1100141429 12:91623351-91623373 CTATGAGCTTGTGTGGCAAATGG - Intergenic
1100645231 12:96522546-96522568 CTTTGAGGCTGTGGAGAAGATGG + Intronic
1100852816 12:98731224-98731246 CTATGTGTTTGTGGGGGAAAGGG - Intronic
1102398556 12:112609085-112609107 CTGTGAGGATTTGGGGAAGATGG - Intronic
1105811541 13:24000588-24000610 CTATGAAGTGGTGGAGAAGACGG + Intronic
1106601755 13:31194267-31194289 GAATGAGTTTGTGGAGAAAAAGG - Intergenic
1107387347 13:39926282-39926304 GTATGAGTGTGATGGGAAGAGGG + Intergenic
1108463953 13:50695653-50695675 ATAAGAGTTTGTGGAGATGAAGG + Intronic
1109538073 13:63741420-63741442 CTAAGAGCCAGTGGGGAAGAGGG + Intergenic
1110563935 13:76939075-76939097 TTTTTAGTTTGTGGGGAAAAAGG + Intergenic
1110891983 13:80706029-80706051 CTAAGAGTCGGGGGGGAAGAGGG - Intergenic
1111470839 13:88680400-88680422 ATATGAGTGTCTGGGGAAAAAGG + Intergenic
1113098326 13:106690068-106690090 TGATGAGGTTGTGGGGAAAAAGG + Intergenic
1113978665 13:114252404-114252426 GTATGAATTTGGGGGGCAGAGGG + Intronic
1116242969 14:42370427-42370449 ATATGAATTTGTGGTGAAGGGGG - Intergenic
1116349362 14:43839957-43839979 ATATAAGTGTGTGGAGAAGAGGG - Intergenic
1116590537 14:46765843-46765865 CTATGTGTTTGTGGTGATGCTGG - Intergenic
1117235209 14:53767266-53767288 CTATGTGTTTGTGGTGATGCTGG - Intergenic
1117502599 14:56368297-56368319 CTATTAGTTTGTGAGGATAATGG + Intergenic
1118652418 14:67911286-67911308 CTATGAGTTTGTTGGAAATGAGG + Intronic
1119987834 14:79159642-79159664 CAAAAAGTTTGTGGGGACGATGG - Intronic
1120118277 14:80646035-80646057 CCAGGAGTTAGTGGGGAAGGAGG + Intronic
1120217811 14:81699319-81699341 CTATGACTTTGGAGGGAACAGGG - Intergenic
1120423900 14:84322909-84322931 CCAGGAGTTTGTGGAGTAGAGGG + Intergenic
1121101791 14:91254427-91254449 CTGTGAGGATGTGGGGCAGAGGG - Intergenic
1121548080 14:94777386-94777408 TTATGAGTGTGTGTGGAAGAGGG - Intergenic
1125430105 15:39585089-39585111 TTATGTGTTTGGGGGGAGGAAGG - Intronic
1126981850 15:54253408-54253430 CTATGAGTTTTGGGCCAAGAAGG - Intronic
1128485705 15:68085364-68085386 CTATTAGTAGGTGGGGAAAAAGG + Intronic
1128697618 15:69780398-69780420 ATATGAGTTTGCGGGGAAAGAGG - Intergenic
1129205820 15:74036511-74036533 CCATGAGTGTGGGAGGAAGAGGG - Intronic
1130303543 15:82698438-82698460 CTATGAGGGTGTGGGGGAGCGGG - Intronic
1130386583 15:83417320-83417342 ATATGAATTTGGGGGGAAGGTGG + Intergenic
1132037268 15:98495155-98495177 CTATGAGGTTGTGGAGAAAGGGG - Intronic
1132138721 15:99370468-99370490 CTATGAGTATCTTGGGAAGGGGG + Intronic
1132878995 16:2153000-2153022 CCATGAGCGTGTGGTGAAGAGGG + Exonic
1134138072 16:11693056-11693078 CTGTAAGTTTGTGGGGAAGAGGG - Intronic
1134505146 16:14799360-14799382 TTATGGGTGAGTGGGGAAGAAGG - Intronic
1134575430 16:15329550-15329572 TTATGGGTGAGTGGGGAAGAAGG + Intergenic
1134727015 16:16426942-16426964 TTATGGGTGAGTGGGGAAGAAGG - Intergenic
1134806086 16:17126601-17126623 CTAAGAGTATGTTGGGGAGAGGG - Intronic
1134940422 16:18284913-18284935 TTATGGGTGAGTGGGGAAGAAGG + Intergenic
1136604730 16:31325600-31325622 CTCTGAGTTTTCCGGGAAGATGG - Exonic
1138771429 16:59668640-59668662 CTATGTTTTTGTGGGGAAAATGG + Intergenic
1139089191 16:63623320-63623342 CTATCATATTGTGGGGGAGAAGG + Intergenic
1139328484 16:66169713-66169735 ATATGAGCTTGTGGATAAGAAGG + Intergenic
1139404376 16:66706607-66706629 GCATGGGTTTCTGGGGAAGAAGG + Intergenic
1139706264 16:68742852-68742874 TTATGAGTTTGAGGGGTAGGGGG - Intronic
1144317328 17:14074973-14074995 CCATGAATTTGTGGGCAATATGG + Intronic
1144658608 17:17053688-17053710 CTGTGATTTTGTGGGCAAGCTGG + Intronic
1145745363 17:27315102-27315124 CCATTTGTCTGTGGGGAAGAAGG + Intergenic
1145899712 17:28482650-28482672 CTAGGAATTTGTCTGGAAGACGG - Intronic
1147306223 17:39566301-39566323 CCATTAGTTTGTTGGCAAGAGGG + Intergenic
1148512091 17:48179896-48179918 TTATGAGATTGTAGGGAAGTGGG - Intronic
1148557966 17:48589887-48589909 GTCTGACTTTGTGGGGAAAAGGG - Intronic
1151944259 17:77310957-77310979 ACATGAGTTTGTGGGGGACACGG - Intronic
1152088115 17:78232377-78232399 CTGTCAGTTTTGGGGGAAGACGG - Intronic
1152223730 17:79083079-79083101 GTATGAGTGTCTGGAGAAGAAGG + Exonic
1152236554 17:79142020-79142042 CTCTGAGTTTGTGGGAAGGGAGG + Intronic
1153357869 18:4157812-4157834 CTGTGAGTAAGTGGGGAAGCTGG + Intronic
1153799858 18:8659488-8659510 AGATGAGATTGTGGGGAGGAGGG + Intergenic
1155400961 18:25438392-25438414 ATATCAATATGTGGGGAAGAAGG - Intergenic
1155942869 18:31817102-31817124 CTTTCAGTTTGGGAGGAAGATGG - Intergenic
1156476182 18:37406845-37406867 TTATGGGGTTGTGGGGAAGTGGG + Intronic
1157460711 18:47890271-47890293 CTTTGAGGTTATGGGGAATAGGG - Intronic
1158051120 18:53221322-53221344 CTATGACTGTGTGGGGAAATGGG - Intronic
1158181407 18:54718785-54718807 TTATGATTTTATGGGGGAGATGG + Intronic
1162120160 19:8460369-8460391 TTATGAGTTTGTGAGGAGGATGG + Intronic
1163869151 19:19803650-19803672 CTCTGAATTTGTAGTGAAGAGGG - Intronic
1163903511 19:20129610-20129632 CTCTGAATTTGTAGTGAAGAGGG - Intergenic
1163911999 19:20203876-20203898 CTCTGAATTTGTAGTGAAGAGGG - Intergenic
1163917311 19:20252462-20252484 CTCTGAATTTGTAGTGAAGAGGG + Intergenic
1163925095 19:20333427-20333449 CTCTGAATTTGTAGTGAAGAGGG + Intergenic
1163931087 19:20392841-20392863 CTCTGAATTTGTAGTGAAGAGGG + Intergenic
1163932310 19:20407750-20407772 CTCTGAATTTGTAGTGAAGAGGG - Intergenic
1163941404 19:20498372-20498394 CTCTGAATTTGTAGTGAAGAAGG + Intergenic
1163956296 19:20644471-20644493 CTCTGAATTTGTAGTGAAGAGGG - Intronic
1163959915 19:20679945-20679967 CTCTGAATTTGTAGTGAAGAGGG + Intronic
1163974518 19:20837247-20837269 CTCTGAATTTGTAGTGAAGAGGG - Intronic
1164001230 19:21101311-21101333 CTCTGGGTTTGTAGTGAAGAGGG + Intronic
1164007994 19:21169514-21169536 CTCTGGGTTTGTAGTGAAGAGGG + Intronic
1164134431 19:22400578-22400600 CTATGGGTTTGTAGTGGAGAGGG - Intronic
1164164381 19:22656195-22656217 CTATGGGTTTGTAGTGGAGAGGG + Intronic
1164224441 19:23229704-23229726 CTATGGGTTTGTAATGAAGAGGG - Intronic
1164253284 19:23503658-23503680 CTCTGGGTTTGTAGTGAAGAGGG - Intergenic
1164285258 19:23810012-23810034 CTCTGGGTTTGTGGTGAAGAAGG + Intronic
1164297140 19:23922048-23922070 CTCTGGGTTTGTAGTGAAGAGGG + Intronic
1164317628 19:24107842-24107864 CTCTGGGTTTGTAGTGAAGAGGG + Intronic
1164423195 19:28115925-28115947 CTAAGAGTTCGGGGAGAAGATGG + Intergenic
1165770267 19:38375838-38375860 CCAATAGATTGTGGGGAAGATGG + Intronic
1167575833 19:50317053-50317075 CTATGGGATTGAGGGGGAGAGGG - Intronic
1167695942 19:51015721-51015743 CTGTGAGTCTGAGGGGAGGAGGG - Intronic
1168456005 19:56508963-56508985 TTATGAGTTTGTGAGAGAGAGGG + Intronic
925122124 2:1427466-1427488 CCATGAGTGTGTGGGGGTGAGGG + Intronic
925744039 2:7029797-7029819 TTCTGAGCTTGTGGGAAAGAAGG - Intronic
928664577 2:33537846-33537868 ATATAAAGTTGTGGGGAAGATGG - Intronic
929074232 2:38064850-38064872 CCATGTGTTGGTGGGGAAGTGGG + Intronic
929262766 2:39884019-39884041 CTATGAGGCTGAAGGGAAGATGG + Intergenic
931497739 2:62828654-62828676 TTTTGAGTTTGTGGGTAAGAGGG - Intronic
931534156 2:63253744-63253766 CTGTGAGGTTGTGGAGAAAAGGG + Intronic
933427219 2:82128531-82128553 CTAAGAGTTTGTGGAGACCAAGG - Intergenic
933462732 2:82609690-82609712 CTATGACAGTGTGGGCAAGAAGG + Intergenic
934729047 2:96644902-96644924 CCATGAGGTGGTGGGGAAGATGG - Intergenic
935864741 2:107374914-107374936 GTAGGAGTTTTTGGTGAAGAGGG - Intergenic
935886712 2:107628456-107628478 CCATGGGTTTGGGGGGAAGTGGG - Intergenic
936721981 2:115262961-115262983 CTATGTATTTATGGGGAAAAGGG - Intronic
937961990 2:127467113-127467135 CTATCAGTGTGTGGGTAAAATGG - Intronic
938890151 2:135696329-135696351 GGAAGAGTTTATGGGGAAGAAGG + Intronic
939638758 2:144614049-144614071 CTCTGAGTGTTTGGGGCAGAAGG - Intergenic
940020410 2:149150595-149150617 CTAAAAGTTTCTGGAGAAGAAGG - Intronic
944564954 2:200980506-200980528 ATATGTCCTTGTGGGGAAGAGGG + Exonic
944932348 2:204532649-204532671 CTAAGAGTTTGTGTGGAAAAGGG - Intergenic
945227817 2:207550487-207550509 TTACTAGGTTGTGGGGAAGATGG + Intronic
947251886 2:228115822-228115844 CTATGAGTTGGTGGGGTGGGTGG - Intronic
947861630 2:233362914-233362936 CTATGTGTTTGTGGTGATGCTGG + Intronic
1169514361 20:6299776-6299798 GCATGGGTTTGTGGGGAAGAAGG + Intergenic
1170681870 20:18533179-18533201 CCATGAGTTGGTGTGGAAGTGGG + Intronic
1170916406 20:20630899-20630921 TTTTTAGTTTGTGGGGAAAATGG - Intronic
1171149402 20:22813961-22813983 CTATTGGTTGGTGGGGAGGAAGG - Intergenic
1172873174 20:38148290-38148312 CCATGAGTGTGTGACGAAGAGGG + Intronic
1173223090 20:41145484-41145506 CCATGGGTTGGTGGGGAAGGCGG - Intronic
1173258900 20:41415563-41415585 CTATGAGTTTGAGGTGGAGAGGG - Exonic
1173265161 20:41472463-41472485 TTATGGGTATGTGGTGAAGAAGG - Intronic
1173644777 20:44626547-44626569 CTATGAGTTTGTAGAGATGAAGG - Exonic
1177323431 21:19551984-19552006 CTCAGAGTTTTTGGGGAAGGAGG - Intergenic
1179369673 21:40792937-40792959 TTATGAGATTCTGGGGAGGAGGG + Intronic
1181275813 22:21686917-21686939 CTACCAGTTTGTGAAGAAGAAGG + Exonic
1181338515 22:22159952-22159974 TCATGAGTTTGTGGGGAAGTGGG + Intergenic
1181992663 22:26849356-26849378 CTAGGAGTATGTGTGGAAGTGGG + Intergenic
1182074453 22:27485824-27485846 CAATGAGCCTGTGGGGAAGCAGG - Intergenic
1182755140 22:32673221-32673243 CTATGGAGCTGTGGGGAAGAGGG + Intronic
1184441417 22:44518839-44518861 CCATGGGGTTGTGGGGCAGAGGG + Intergenic
1184646401 22:45897612-45897634 CTATGGGGCTGTGGGGAAGATGG + Intergenic
949497226 3:4644034-4644056 ATATGAGTCTGTGCTGAAGAAGG - Intronic
949576960 3:5347732-5347754 GAAAGGGTTTGTGGGGAAGAAGG - Intergenic
949786859 3:7751454-7751476 TTATGAGATTGTGGAGAAAAAGG + Intergenic
949926080 3:9042942-9042964 GAAAGAGTTTTTGGGGAAGAGGG - Intronic
949931745 3:9083970-9083992 ATTTGAGTTTGCGGGGATGAGGG - Intronic
951545657 3:23822402-23822424 ATATAATTTTGTGGGGAGGATGG + Intronic
951680500 3:25289878-25289900 CTAAGACTTTGTGGGGAATGAGG + Intronic
952114262 3:30160113-30160135 TCATGAGTTTGTGGTGAAGCTGG + Intergenic
952929768 3:38350013-38350035 ATATGAGTTTTAGGGGCAGAGGG + Intronic
954608909 3:51933987-51934009 CAGTGAGTTTGTGAGGATGAAGG + Intronic
955353905 3:58214861-58214883 CTTAGAGTTTGCGGGGAGGAAGG + Intergenic
955862017 3:63341045-63341067 CCAGGAGTTAGTGGGGAAGAAGG - Intronic
956029877 3:65025995-65026017 CTCGCAGTTTGTTGGGAAGATGG + Intergenic
957036379 3:75297049-75297071 CTGTGAGTGTGGAGGGAAGAAGG - Intergenic
959718569 3:109461306-109461328 CTAGGCGTATGTGGGGAATAGGG + Intergenic
960621117 3:119637776-119637798 CTCTGAGATGGTGGGGCAGAGGG - Intronic
962825544 3:139096969-139096991 CTCTGAGTCTCTGAGGAAGAGGG - Intronic
962988668 3:140558868-140558890 ATTTGAGTTTGTGGGGAGGGTGG + Intronic
963667453 3:148206965-148206987 CTATGAGTCTGTAGGAAAAATGG + Intergenic
964033024 3:152161854-152161876 GTATGACTTTTTGGGGGAGAAGG - Intergenic
964541347 3:157783088-157783110 CTATTTCTTTGTGGAGAAGAAGG - Intergenic
965122617 3:164581627-164581649 TTTTGATTTTGGGGGGAAGATGG - Intergenic
967809819 3:193748347-193748369 CTATGAAGTTGTGGAAAAGAAGG - Intergenic
968120479 3:196122472-196122494 GTCTGAGTTTGTGGGGAAACGGG + Intergenic
972520758 4:39853745-39853767 CTATGAATTGGGGAGGAAGAAGG - Intronic
973260083 4:48154532-48154554 AGATGAGTTTTTGGTGAAGAAGG + Intronic
973851446 4:54965387-54965409 ATATGAATTTTTGGGGAAGGAGG - Intergenic
973870605 4:55162180-55162202 TTATGTTTTGGTGGGGAAGATGG - Intergenic
974255301 4:59445594-59445616 CTATGACTTTTTGAGAAAGAAGG - Intergenic
974858149 4:67485217-67485239 ATATGATTTTGAGGGGAATAGGG - Intronic
974897432 4:67956478-67956500 CTATGAATCTGTTGGGAATAAGG + Intronic
975448913 4:74501307-74501329 CTATGTGTGTGAGGGGAAAAGGG + Intergenic
976163190 4:82225904-82225926 TGATGAGGTTGTGGGGAAAAAGG + Intergenic
978481960 4:109203020-109203042 CTAGGACTTTTGGGGGAAGAAGG - Intronic
979357628 4:119724148-119724170 ATATGAGATTGTAGGGAAGAAGG + Intergenic
979835318 4:125359798-125359820 CTGTGTGTTTGTGGGGAGGGAGG + Intronic
981528924 4:145733649-145733671 CTAGGAGTTTGTGGGGCGGGAGG - Intronic
981978726 4:150765491-150765513 CTATGAGTGTGTAGGGGAAAGGG + Intronic
985993441 5:3582770-3582792 CTATGAATTGATGAGGAAGATGG - Intergenic
986363260 5:7002674-7002696 CTATGTGCTTGTGGGGAGAAGGG + Intergenic
988717355 5:33841227-33841249 CTGTGAGGTTGTGGGGCAGGAGG - Intronic
988887747 5:35577346-35577368 CCATGGGTTAGTGGGGAGGAAGG - Intergenic
989624078 5:43412786-43412808 CCATGAGTTTCTGGGGACAAGGG + Intergenic
989651250 5:43692947-43692969 CTTTGAGTATGTGAGAAAGAAGG - Intronic
990121293 5:52456380-52456402 CTCTGACTGTGTGGGGAACAAGG + Intergenic
992777599 5:80102180-80102202 CTATGAGTATTTAGAGAAGAAGG - Intergenic
995926059 5:117376021-117376043 AAATGAATTTGTGGGGAAAAAGG - Intergenic
995991285 5:118242746-118242768 CTATGAGTTGGTAATGAAGAAGG - Intergenic
996750493 5:126883688-126883710 CTACTGGTTGGTGGGGAAGAGGG + Intronic
996863124 5:128087242-128087264 TTATGAGTTATTGGGGAAGGGGG + Intronic
997053150 5:130407053-130407075 TGATGAGTTTGTGGAGAAAAAGG - Intergenic
997117630 5:131142479-131142501 CCAAGAGTTAGTGGGGAGGAAGG + Intergenic
997312230 5:132896630-132896652 TTAGGAGTTTGTGAGGAAGGAGG + Exonic
998231176 5:140362262-140362284 CTCTGAGGCTGTGGGGAGGATGG + Intronic
1000182711 5:158827754-158827776 GTAGCAGTTTGTGGGGAAGAAGG + Intronic
1001150166 5:169220277-169220299 CTTCCAGTTTGTGAGGAAGAGGG - Intronic
1001891050 5:175339065-175339087 CTAAGAGATTGTGGTGCAGAGGG - Intergenic
1002831037 6:821079-821101 TTTGGAGTTTCTGGGGAAGAGGG - Intergenic
1003830363 6:10003366-10003388 CTTTGAGATTTTGGGGAAGTGGG - Intronic
1004341961 6:14815722-14815744 CTTCTAGTTGGTGGGGAAGACGG + Intergenic
1004946855 6:20624573-20624595 ATATGAGTTTGTGGGGCTCATGG - Intronic
1005825144 6:29627893-29627915 CCCTGATTTTGTGGGGAGGAGGG + Intronic
1006381005 6:33697151-33697173 CTCTGAGTCAGTGGGGATGAGGG + Exonic
1007364993 6:41385032-41385054 CTGTGTGTATGTGGGGAAGGGGG - Intergenic
1007593123 6:43035431-43035453 CTTTGAGTTTCTGGTGGAGAAGG + Intergenic
1007961159 6:45960730-45960752 CTAGGTGTTAGTGGAGAAGAAGG - Intronic
1008256400 6:49306100-49306122 CTATGAGTTTCTGGAGCAGAAGG - Intergenic
1009547351 6:65036817-65036839 CGGTGAGGTTGTGGGGAAAAGGG + Intronic
1009640437 6:66328519-66328541 CTATGTGTGTGTGTTGAAGAGGG - Intergenic
1010054573 6:71550643-71550665 ATATGTGTTTGGGGGGAAGTGGG - Intergenic
1012156406 6:95825023-95825045 TTATGAGGTTGTGGAGAAAAAGG + Intergenic
1012550499 6:100461019-100461041 GTGTGAGTTTATGGGGAGGAGGG - Intronic
1014004044 6:116396950-116396972 CTATGAGCATATGGGTAAGAAGG - Intronic
1014173228 6:118302525-118302547 CTATGTATTTTTGAGGAAGATGG - Intronic
1014554569 6:122830081-122830103 TTATGTGTCTGTGGGGCAGAGGG - Intergenic
1014594335 6:123314354-123314376 CGATGAGGTTGTGGAGAAAAAGG + Intronic
1014690551 6:124558601-124558623 CTAAGAGTTGGTGGGCAGGAAGG + Intronic
1014734573 6:125077472-125077494 CTATGTGTTGTTGAGGAAGAGGG - Intronic
1015176465 6:130314444-130314466 CTTTGATTTTGTGGGTAAAATGG - Intronic
1015367855 6:132416901-132416923 CTAGGAGCTAGTGGAGAAGAAGG - Intergenic
1015721573 6:136248121-136248143 ATATGAGATTGTAAGGAAGACGG - Intronic
1017417893 6:154241470-154241492 CAAAGAGTTTGTGAGTAAGAAGG - Intronic
1017470944 6:154736177-154736199 CAAAGTGTGTGTGGGGAAGAGGG - Intronic
1017780173 6:157709670-157709692 CTATGAATTTGTGGGGGAGGGGG + Intronic
1019693877 7:2433644-2433666 CTACGACTTCGTGGGGAAGCTGG + Exonic
1019957976 7:4432146-4432168 CTATGAAATTGTGAAGAAGAGGG + Intergenic
1020571538 7:9869693-9869715 CCATGTGTTTGTGGTGAAGCTGG + Intergenic
1021774597 7:24040257-24040279 TTATGAGCTAGTGGGGCAGACGG + Intergenic
1022859559 7:34353392-34353414 CTATGATGTTGTGAGGAAGAGGG - Intergenic
1023818359 7:43966637-43966659 CTATGAGGATGTGGTGAACAGGG + Intergenic
1024160857 7:46674037-46674059 CTATGACTTTTTGGTGATGATGG + Intronic
1024578921 7:50785988-50786010 CTGTGCGTGTGTGGGGCAGAGGG + Intronic
1026092124 7:67308997-67309019 CTGTGAGTTTGTGGGGACATTGG + Intergenic
1026879516 7:73899910-73899932 CTGTGAGTCAGTGGGGCAGATGG - Intergenic
1027510498 7:79073335-79073357 CTAAGAGTTAGTGGAGAACAAGG - Intronic
1029338711 7:99924823-99924845 CTGTCATTTTGTGGGGAAGAGGG + Intronic
1029540778 7:101180689-101180711 CTATCAGTTTCCGGGGACGAAGG - Intergenic
1029728425 7:102423999-102424021 GTATGAGGTTGAGGGGAAAAAGG + Intronic
1029742988 7:102501469-102501491 CTATGAGGATGTGGTGAACAGGG + Intronic
1029760978 7:102600630-102600652 CTATGAGGATGTGGTGAACAGGG + Intronic
1031100668 7:117476235-117476257 CAAGGAGGTTGTAGGGAAGAGGG + Intronic
1031283584 7:119837699-119837721 TTTTGTTTTTGTGGGGAAGAAGG - Intergenic
1031597643 7:123666493-123666515 CTATGAGTTTCCAGGGAGGATGG - Intergenic
1031976247 7:128095410-128095432 CTGTGAGCAGGTGGGGAAGAAGG + Intergenic
1034681426 7:152931371-152931393 CTATGAGTTTATGTGGAAATAGG + Intergenic
1035308777 7:157952019-157952041 CTGTGAGCTTGGGAGGAAGATGG - Intronic
1035842941 8:2832192-2832214 CCGTGAGTCTGTGGGGAGGAGGG + Intergenic
1035888415 8:3318457-3318479 CTATGAGTTTCTGGTGAGCAAGG - Intronic
1037128822 8:15383556-15383578 GAATGAGTGTTTGGGGAAGAAGG - Intergenic
1037282213 8:17254499-17254521 CTAAGAGTTTGGGGGGAAGAAGG - Intronic
1037713685 8:21377462-21377484 GTAGGAGTTAGTGGGGAAGGAGG + Intergenic
1039737869 8:40351765-40351787 CGGTGAGGTTGTGGAGAAGAAGG - Intergenic
1041168957 8:55120875-55120897 CCAGGAGTTTGTGGGGATGGAGG - Intronic
1041422153 8:57679600-57679622 GTATGTGTTTGTAGAGAAGATGG - Intergenic
1041426971 8:57732683-57732705 CTATGTGTTTGTGGTGATGCTGG - Intergenic
1043479079 8:80634399-80634421 ATGTGAGTTTGTGGGGCTGATGG + Exonic
1046049880 8:109010233-109010255 CAATGAGGTTGTGTGGTAGATGG - Intergenic
1047660774 8:127033972-127033994 CTAGGAGTTAGTGGGGAGGAGGG + Intergenic
1048270273 8:133022692-133022714 CTAGGAGTCAGTGGGGAAGATGG - Intronic
1048528385 8:135225316-135225338 CTATGATTGTGTGAGGAATAGGG - Intergenic
1048685266 8:136898036-136898058 CAAAGAGGATGTGGGGAAGAGGG + Intergenic
1049290379 8:141798485-141798507 CTCTGAGTGTGTGGGGGAGTGGG + Intergenic
1050478413 9:6064594-6064616 CCACGGGATTGTGGGGAAGAAGG + Intergenic
1051108864 9:13612015-13612037 ACATGAGTTTGTGGGGGAGGGGG + Intergenic
1055364776 9:75531385-75531407 TAATGAGGTTGTGGGGAAAATGG - Intergenic
1055425368 9:76190065-76190087 CTATGCCTGTGTGGGGAAAACGG - Intronic
1056044265 9:82700800-82700822 CTATGAGTTTAGGGGGAAAAAGG - Intergenic
1056847361 9:90052328-90052350 CTCTGAGTTGGAGTGGAAGAAGG - Intergenic
1057099370 9:92343435-92343457 GTAGGAGTTTGTGGGGAAAGTGG + Intronic
1057933388 9:99215545-99215567 CTCTGAGCTTGTGTGTAAGATGG + Intergenic
1059202769 9:112433372-112433394 GTTTGAGAGTGTGGGGAAGATGG + Intronic
1059685230 9:116628811-116628833 CTATGTGTATATGGGGTAGAGGG + Intronic
1061097906 9:128470643-128470665 CTTTGAGTTATAGGGGAAGAAGG - Intronic
1185836898 X:3353072-3353094 CTAGAAGCTTGTGAGGAAGAAGG + Intergenic
1188883490 X:35519503-35519525 CTATATGTTTGTGGGGAGAAGGG + Intergenic
1190431737 X:50384575-50384597 GTGTGAGTTTCTGGGAAAGACGG + Intronic
1192083138 X:68067469-68067491 CAATGATTTTGGGGGGCAGAGGG + Intronic
1192826677 X:74704495-74704517 CTGTGTGTTTGTGGGGGAAATGG - Intergenic
1193408434 X:81133212-81133234 CTGTGAGGTTGTGGAGAAAAAGG + Intronic
1196906432 X:120441455-120441477 GTTTTAGTTTGTAGGGAAGATGG - Intronic
1197276017 X:124480115-124480137 CTAGAAGTTGGTGGGGAAGTGGG + Intronic
1197569730 X:128134075-128134097 CCAAGGGTTTGGGGGGAAGAAGG + Intergenic
1198655060 X:138904754-138904776 CTCTGAGTTAGTTGGGAAAAGGG + Intronic
1199159589 X:144593008-144593030 GTATGGGTTTGAGGGGAAGGTGG - Intergenic
1199164933 X:144660573-144660595 CTGTGAGGTTGTGGGGAAAAGGG - Intergenic
1200729648 Y:6720554-6720576 CATTCAGTTTATGGGGAAGAGGG - Intergenic