ID: 1074832308

View in Genome Browser
Species Human (GRCh38)
Location 10:117257514-117257536
Sequence TGATAAAACCATAATTGGGT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1074832300_1074832308 23 Left 1074832300 10:117257468-117257490 CCCCAAGCAAGCTACTGCATTAA 0: 1
1: 0
2: 1
3: 15
4: 125
Right 1074832308 10:117257514-117257536 TGATAAAACCATAATTGGGTAGG No data
1074832302_1074832308 21 Left 1074832302 10:117257470-117257492 CCAAGCAAGCTACTGCATTAATA 0: 1
1: 0
2: 1
3: 8
4: 135
Right 1074832308 10:117257514-117257536 TGATAAAACCATAATTGGGTAGG No data
1074832301_1074832308 22 Left 1074832301 10:117257469-117257491 CCCAAGCAAGCTACTGCATTAAT 0: 1
1: 0
2: 1
3: 28
4: 448
Right 1074832308 10:117257514-117257536 TGATAAAACCATAATTGGGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1074832308 Original CRISPR TGATAAAACCATAATTGGGT AGG Intronic
No off target data available for this crispr