ID: 1074839415

View in Genome Browser
Species Human (GRCh38)
Location 10:117334224-117334246
Sequence GGCATGAAGCCCAACATTAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 89
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 81}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1074839415_1074839418 -8 Left 1074839415 10:117334224-117334246 CCTGTAATGTTGGGCTTCATGCC 0: 1
1: 0
2: 0
3: 7
4: 81
Right 1074839418 10:117334239-117334261 TTCATGCCCAGCACTTTGGGAGG No data
1074839415_1074839426 30 Left 1074839415 10:117334224-117334246 CCTGTAATGTTGGGCTTCATGCC 0: 1
1: 0
2: 0
3: 7
4: 81
Right 1074839426 10:117334277-117334299 TGGATGAAGCTGGTTGAAGCAGG No data
1074839415_1074839424 10 Left 1074839415 10:117334224-117334246 CCTGTAATGTTGGGCTTCATGCC 0: 1
1: 0
2: 0
3: 7
4: 81
Right 1074839424 10:117334257-117334279 GGAGGTTGAAGCTGGTGGGCTGG No data
1074839415_1074839423 6 Left 1074839415 10:117334224-117334246 CCTGTAATGTTGGGCTTCATGCC 0: 1
1: 0
2: 0
3: 7
4: 81
Right 1074839423 10:117334253-117334275 TTTGGGAGGTTGAAGCTGGTGGG No data
1074839415_1074839422 5 Left 1074839415 10:117334224-117334246 CCTGTAATGTTGGGCTTCATGCC 0: 1
1: 0
2: 0
3: 7
4: 81
Right 1074839422 10:117334252-117334274 CTTTGGGAGGTTGAAGCTGGTGG 0: 5
1: 219
2: 5562
3: 62328
4: 157949
1074839415_1074839421 2 Left 1074839415 10:117334224-117334246 CCTGTAATGTTGGGCTTCATGCC 0: 1
1: 0
2: 0
3: 7
4: 81
Right 1074839421 10:117334249-117334271 GCACTTTGGGAGGTTGAAGCTGG 0: 98
1: 4722
2: 75264
3: 195182
4: 242663
1074839415_1074839425 20 Left 1074839415 10:117334224-117334246 CCTGTAATGTTGGGCTTCATGCC 0: 1
1: 0
2: 0
3: 7
4: 81
Right 1074839425 10:117334267-117334289 GCTGGTGGGCTGGATGAAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1074839415 Original CRISPR GGCATGAAGCCCAACATTAC AGG (reversed) Intronic
905099538 1:35507010-35507032 AGCAGGCAGCCCAACATGACTGG + Exonic
907044857 1:51294479-51294501 GGCCTGAAGCTCAAGATTGCTGG - Exonic
908598865 1:65718024-65718046 TGCAAGAACCCCAGCATTACTGG - Intergenic
909340470 1:74525865-74525887 GGTAAGAACCCCCACATTACTGG + Intronic
911241255 1:95470238-95470260 TGCATGAACCACAACATTACTGG - Intergenic
912018326 1:105071319-105071341 GGCTTGAAGCCCAAGTCTACTGG - Intergenic
918593261 1:186263339-186263361 GGCATAAACCCAAACATTAGAGG + Intergenic
921473562 1:215577693-215577715 GGCATGAAGCAGAATTTTACGGG + Exonic
924439300 1:244073295-244073317 AGCAAGAAGCCCAAAATTAAGGG + Intergenic
1063143491 10:3275881-3275903 GGCATGAAGCCCCACAGCAGTGG + Intergenic
1063579240 10:7290928-7290950 GGCTTGAAATCCAACATTAGTGG - Intronic
1069317471 10:67124882-67124904 GCCATGAATGCCAACATTATTGG - Intronic
1074839415 10:117334224-117334246 GGCATGAAGCCCAACATTACAGG - Intronic
1075353209 10:121744940-121744962 GCCATGAAGTCCAACGTTCCAGG - Intronic
1075505949 10:123022488-123022510 GACATGAACCCCAAAATTCCTGG + Intronic
1081824819 11:46039020-46039042 AGCAAGGAGCCCAAAATTACTGG + Intronic
1082853502 11:57786064-57786086 GCCATTAAGTCCTACATTACTGG - Intronic
1085374947 11:76051991-76052013 GGCAAGAAGGCCAACAGAACTGG - Intronic
1088962350 11:114681722-114681744 GGCATGTATTCCAAAATTACGGG - Intronic
1089846102 11:121459832-121459854 GGCATGAAGACAAACACTACAGG + Intronic
1097356789 12:58611224-58611246 GGCATGCAGCAGTACATTACAGG - Intronic
1099147979 12:79071793-79071815 GGCCTTAAGTCCAACATAACTGG - Intronic
1101190943 12:102331685-102331707 TGCACGAAGCCCAACCATACTGG - Intergenic
1102430661 12:112880504-112880526 GGGATGGAGCCCATCTTTACAGG + Intronic
1108853190 13:54761410-54761432 GGCATGAACCACACCATTCCTGG - Intergenic
1109590033 13:64466652-64466674 GCCATGAAGACAAACATTATTGG + Intergenic
1112262502 13:97890048-97890070 GGCAGGAAGCCCAACAGGAGAGG + Intergenic
1128255443 15:66192719-66192741 GGCAGGAAGAGCAACATTATTGG + Intronic
1132786403 16:1659068-1659090 GGGATGAAGCCCAACTTTGGGGG - Intronic
1139694969 16:68667501-68667523 GTCCTGATGTCCAACATTACTGG - Intronic
1143777223 17:9207435-9207457 GAGATGAAGCCCGACATGACAGG - Intronic
1151074511 17:71255716-71255738 GGCATGAAGCCGAGCATAAGAGG - Intergenic
1151187475 17:72374535-72374557 GGCAAGGAGCCCAACATTTATGG + Intergenic
1165964268 19:39562434-39562456 TGCAAGAATCACAACATTACTGG - Intergenic
927968105 2:27284584-27284606 GGCATGAAGTCCTACATGAGAGG + Intronic
928444273 2:31319080-31319102 TGCATGAAGCCCCACCTTGCTGG - Intergenic
929293234 2:40216750-40216772 GAAAAGAAGCCCAACATCACTGG - Intronic
937224738 2:120361945-120361967 GGCATTAAGACCAGCAATACCGG + Intergenic
937512626 2:122612666-122612688 GGCAAGAACCACAGCATTACTGG + Intergenic
941634716 2:167924204-167924226 GGCATCAAACTCAAAATTACAGG + Intergenic
945440096 2:209868026-209868048 AGGCTGAAGACCAACATTACAGG - Intronic
946832843 2:223743337-223743359 GTCATGAACCCCAACACTTCAGG + Intergenic
1168873849 20:1155871-1155893 GGAATAAAGTCCAAAATTACTGG + Intronic
1170556735 20:17520813-17520835 GGCATGAAGCCCTACCTTCAGGG - Intronic
1172510076 20:35494488-35494510 GGCATGAAGACCAAGATGGCAGG - Intronic
1177456445 21:21345047-21345069 TGCAAGAACCTCAACATTACTGG + Intronic
1181615158 22:24049323-24049345 GGCATGAAGCCCCAGAGCACAGG - Intronic
1182072540 22:27473928-27473950 GGCATGTAACCCAACCTTGCTGG - Intergenic
952356512 3:32590034-32590056 GGCATCATTCCCAACATTATTGG + Intergenic
953157237 3:40386583-40386605 GGCCTCACTCCCAACATTACAGG + Intergenic
961927990 3:130503466-130503488 GGGATGAAACCCAACATTTTTGG + Intergenic
965655207 3:170976244-170976266 GGCCAGTAGCCCACCATTACAGG + Intergenic
967907437 3:194513288-194513310 GGCCTGAAGTCCAACATTTAAGG + Intergenic
971565922 4:28141518-28141540 GGTTAGCAGCCCAACATTACAGG - Intergenic
974517905 4:62940784-62940806 CGCAGGAAGCCCAACAATATTGG - Intergenic
975369368 4:73567468-73567490 GGCAAGAAACACAACATTGCCGG - Intergenic
978223608 4:106306818-106306840 GGGATTAAGCCAAACATGACAGG + Intronic
978443865 4:108762631-108762653 GGCAGGAAGCCCAGCGTTCCGGG + Intronic
979223696 4:118260347-118260369 CGCATGATGCCCAACAACACTGG + Intergenic
983215373 4:164997640-164997662 GGCATCAGTTCCAACATTACTGG - Intergenic
983824544 4:172241607-172241629 GGTATGAAACCCAACATTGCAGG + Intronic
988145977 5:27308993-27309015 GACATGATGCTCAACATCACTGG + Intergenic
991663754 5:68975355-68975377 TGCAAGAAGCACAGCATTACTGG + Intergenic
996627129 5:125583995-125584017 GGCATTTAAACCAACATTACTGG + Intergenic
996961393 5:129254814-129254836 TGCAAGAACCGCAACATTACTGG - Intergenic
1011019091 6:82790179-82790201 TGCAAGAAGCACAGCATTACTGG + Intergenic
1017688812 6:156942703-156942725 GGCATCTAGCCCAACATGGCAGG - Intronic
1019720759 7:2569162-2569184 AGCATGAACCCCAACATGAAAGG - Intronic
1026836373 7:73642302-73642324 TCCATGAAGCCCAACATTTAGGG + Intergenic
1030453467 7:109743429-109743451 GGCATGAAACCCAAAGTTACTGG + Intergenic
1030453669 7:109745541-109745563 GGCATGAAACCCAAAGTTACTGG + Intergenic
1036073969 8:5473844-5473866 GGCATGAATCCCAGCATGGCGGG + Intergenic
1036239164 8:7068081-7068103 GGTATGAAGAACAATATTACAGG + Intergenic
1036240127 8:7074236-7074258 GGTATGAAGAACAATATTACAGG + Intergenic
1036570644 8:9977229-9977251 AGCATGAATCCCAAAATTTCAGG + Intergenic
1036906655 8:12713126-12713148 GGTATGAAGAACAATATTACAGG - Intergenic
1040895744 8:52366479-52366501 AGCAGGAAGCCCAGCATTATTGG - Intronic
1045917560 8:107490541-107490563 GGCATGAACCTGAAGATTACTGG + Intronic
1046510897 8:115201101-115201123 GGTATCAAGAACAACATTACTGG - Intergenic
1047047151 8:121066864-121066886 GGCAGGCAGGCCAAGATTACAGG + Intergenic
1050779670 9:9316696-9316718 GGAATGATGCCCAGCATTACTGG + Intronic
1050870677 9:10564955-10564977 GGCATGAAGTCCAACAATGATGG + Intronic
1053040194 9:34863564-34863586 TGCAAGAAGCACAGCATTACTGG + Intergenic
1061595238 9:131624642-131624664 GGCACGCAGCCCAAGATAACAGG + Intronic
1062486235 9:136777712-136777734 GACATGAAGCGCAACAGCACCGG + Intergenic
1189941767 X:46131019-46131041 GGCTTGAAACACAACATTAGGGG + Intergenic
1191198726 X:57753235-57753257 TGCAAGAACCACAACATTACTGG + Intergenic
1196495483 X:116318970-116318992 TGCAAGAAGCACAACATTAATGG + Intergenic
1200384123 X:155872134-155872156 GTCATTAAGCCCAAAATTACAGG + Intergenic