ID: 1074839526

View in Genome Browser
Species Human (GRCh38)
Location 10:117335482-117335504
Sequence GGCAAAAATAACACCACTGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1074839523_1074839526 27 Left 1074839523 10:117335432-117335454 CCAAAGTTTGTTCTTCTTTTAAT 0: 1
1: 0
2: 8
3: 104
4: 1076
Right 1074839526 10:117335482-117335504 GGCAAAAATAACACCACTGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1074839526 Original CRISPR GGCAAAAATAACACCACTGA TGG Intronic
No off target data available for this crispr