ID: 1074843141

View in Genome Browser
Species Human (GRCh38)
Location 10:117374947-117374969
Sequence GTCTCCCGCGTCGGCGGGGC GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 121
Summary {0: 1, 1: 0, 2: 2, 3: 15, 4: 103}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1074843128_1074843141 27 Left 1074843128 10:117374897-117374919 CCCGCAACTCCCGGAACAGGAAT 0: 1
1: 0
2: 0
3: 15
4: 94
Right 1074843141 10:117374947-117374969 GTCTCCCGCGTCGGCGGGGCGGG 0: 1
1: 0
2: 2
3: 15
4: 103
1074843129_1074843141 26 Left 1074843129 10:117374898-117374920 CCGCAACTCCCGGAACAGGAATA 0: 1
1: 0
2: 0
3: 5
4: 79
Right 1074843141 10:117374947-117374969 GTCTCCCGCGTCGGCGGGGCGGG 0: 1
1: 0
2: 2
3: 15
4: 103
1074843132_1074843141 18 Left 1074843132 10:117374906-117374928 CCCGGAACAGGAATAGGATGGTG 0: 1
1: 0
2: 0
3: 17
4: 190
Right 1074843141 10:117374947-117374969 GTCTCCCGCGTCGGCGGGGCGGG 0: 1
1: 0
2: 2
3: 15
4: 103
1074843133_1074843141 17 Left 1074843133 10:117374907-117374929 CCGGAACAGGAATAGGATGGTGG 0: 1
1: 0
2: 0
3: 14
4: 145
Right 1074843141 10:117374947-117374969 GTCTCCCGCGTCGGCGGGGCGGG 0: 1
1: 0
2: 2
3: 15
4: 103

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1074843141 Original CRISPR GTCTCCCGCGTCGGCGGGGC GGG Exonic
900219768 1:1501906-1501928 GTCTCACTCGTCGCCGAGGCTGG + Intergenic
901005779 1:6170930-6170952 GTCTCCTGCGGTGGCGGGGGAGG - Intronic
902770925 1:18645230-18645252 GTGGCCCGCGTCGGCGGGCTGGG + Intronic
906107789 1:43305099-43305121 TTCTCCTGCGTGGGCGGTGCTGG + Exonic
906950712 1:50333011-50333033 GTCTGGGGCGTCGACGGGGCAGG - Intergenic
908401231 1:63774423-63774445 GCGTCCCGCGGCGGCGCGGCCGG - Exonic
910968635 1:92832195-92832217 GTCTCGCGCGTCGCAGGGGCCGG + Intronic
912682608 1:111738831-111738853 GCTTTCCGCGTCGGCGGCGCGGG + Intronic
914919963 1:151839808-151839830 GCATCCCGCGTCTGCAGGGCGGG + Intronic
915300417 1:154948281-154948303 GTCTGCGGAGACGGCGGGGCCGG - Exonic
922238439 1:223738845-223738867 GTGTCCCGTGACTGCGGGGCAGG - Intronic
1065025365 10:21535055-21535077 GTCTGCTGACTCGGCGGGGCGGG + Intronic
1066065314 10:31757392-31757414 GTCTCCGGCCTCGGGGGGCCTGG + Intergenic
1067015481 10:42754364-42754386 TTCTCCACCGACGGCGGGGCCGG + Intergenic
1070398720 10:76034420-76034442 GTGTCCCCCCTCGGTGGGGCTGG + Intronic
1070610050 10:77926734-77926756 GGCTGCCGCGGCGGCGGGACTGG + Intergenic
1074843141 10:117374947-117374969 GTCTCCCGCGTCGGCGGGGCGGG + Exonic
1078549224 11:12268967-12268989 GTCTCGCTCGTCGCCGAGGCTGG - Intergenic
1080230916 11:30017091-30017113 GCCTCCCGGCGCGGCGGGGCGGG + Intergenic
1081528523 11:43942879-43942901 GCCTCCGGCGTCTGCGGGGCCGG - Exonic
1083885788 11:65572875-65572897 GGGTCCCGCGTTGGCGGCGCCGG - Exonic
1083939504 11:65888159-65888181 GCCTCTGGCGTCGGCGGGGCGGG - Intronic
1084083397 11:66843512-66843534 GCCGCCCGAGTCGGCGGCGCTGG + Exonic
1084192197 11:67504360-67504382 GCCGCCCGCGCCGCCGGGGCCGG + Intronic
1087076220 11:94129099-94129121 GCCTCCGCCGCCGGCGGGGCGGG - Exonic
1087407344 11:97745950-97745972 GTCTGCCGCGTTTGCGGGCCAGG - Intergenic
1091550370 12:1531198-1531220 GGCTCCGGGGTCGGCGGCGCAGG + Intronic
1098550330 12:71755009-71755031 AGCGCCCGGGTCGGCGGGGCCGG + Exonic
1104928463 12:132325931-132325953 GTCGCCCGCGTCGCAGCGGCTGG - Intronic
1106422466 13:29595385-29595407 GCCCCCTGCGTTGGCGGGGCCGG + Intronic
1106602568 13:31200259-31200281 GACGCGCGCGCCGGCGGGGCAGG - Intronic
1116958043 14:50944092-50944114 GTCTCCGGCCGCGGCCGGGCGGG - Intronic
1122130944 14:99604300-99604322 GTCGCCCTCGGGGGCGGGGCCGG - Intergenic
1122783000 14:104151536-104151558 GTCTCCAGCCCCGGTGGGGCAGG - Intronic
1122789096 14:104176872-104176894 GACTTCCGCGTGGGTGGGGCCGG - Exonic
1125717453 15:41827425-41827447 AACTCCCGCGGCGGCGGGGGCGG + Exonic
1132639498 16:971141-971163 CTCCCGCGCGTGGGCGGGGCCGG - Intronic
1132729567 16:1354857-1354879 GTCCCCCGCGTCTGTAGGGCTGG + Intronic
1132729588 16:1354921-1354943 GTCTCCCACGTCTGTGGGGTGGG + Intronic
1132729600 16:1354958-1354980 GTCCCCCGCGTCTGTGGGGTGGG + Intronic
1132729622 16:1355022-1355044 GTCTCCCGCATGTGCGGGGTCGG + Intronic
1132729631 16:1355054-1355076 GTCTGCCGCGTCTGCGGGGTCGG + Intronic
1132729639 16:1355086-1355108 GTCTCCCGCGTCTGCGGGGTCGG + Intronic
1132729648 16:1355118-1355140 GTCTCCCGCCTCTGCGGGGTCGG + Intronic
1132729658 16:1355150-1355172 GTCTCCCGCGTCTGTGGGGTCGG + Intronic
1132729666 16:1355182-1355204 GTCTCCCGCGTCTGTGGGGTCGG + Intronic
1132844160 16:1992355-1992377 GCCTCCCGGGTGGGCGGGGAGGG + Intronic
1134134169 16:11668628-11668650 GGCGCGCGCGGCGGCGGGGCCGG + Intronic
1136923590 16:34351095-34351117 GTCTCCCCTGTAGGGGGGGCGGG - Intergenic
1136980983 16:35060711-35060733 GTCTCCCCTGTAGGGGGGGCGGG + Intergenic
1138426050 16:56932544-56932566 GGCGCCCGCGTCGGCGGGGCAGG - Intronic
1141611097 16:85181634-85181656 GTCTCCCGCTTCGGGTGGGAAGG + Intronic
1150390510 17:64787412-64787434 ACCTCCCGCCTGGGCGGGGCAGG + Intergenic
1151785702 17:76273919-76273941 GTCTACCGAGTGGGCGGGCCTGG + Intergenic
1151954524 17:77373724-77373746 GTCCCCCACGTAGGCGGCGCGGG - Intronic
1158190961 18:54828427-54828449 GTCCGCCGCGGCGGCGGGGCTGG - Exonic
1160447602 18:78939732-78939754 GGCTCACGAGTCGGGGGGGCAGG - Intergenic
1160499018 18:79393404-79393426 GTCTCCAGCGCGGGCCGGGCCGG - Intergenic
1161006813 19:1941261-1941283 GGCTCCCGCGCCGCCTGGGCCGG - Exonic
1161337112 19:3720661-3720683 GTCACCTGGGTGGGCGGGGCTGG - Intronic
1161615222 19:5266479-5266501 GTCTCACTCGTCGGCCAGGCTGG + Intronic
1166100360 19:40567983-40568005 GACCCCCGCGGCGGCGGAGCAGG + Exonic
1166110905 19:40622471-40622493 GTGTGCTGGGTCGGCGGGGCAGG - Exonic
1168346802 19:55653869-55653891 GTCTGCCGCGCCTGCGCGGCGGG + Intergenic
926673844 2:15602727-15602749 GTCTCGCACGTCGCCCGGGCTGG + Intronic
927692278 2:25216381-25216403 TTCTCCTGAGTCTGCGGGGCGGG + Intergenic
928097224 2:28412160-28412182 CTCGTCCTCGTCGGCGGGGCTGG + Exonic
929583842 2:43101371-43101393 GACTCCCGGGTGGGAGGGGCCGG + Intergenic
932635609 2:73385746-73385768 GCCGCCCGCCTGGGCGGGGCCGG - Exonic
933876126 2:86623382-86623404 GACTCCCGCGGCCGCGGGTCAGG + Exonic
938727294 2:134120150-134120172 GGCTCCCGCGGCGGCGGCCCCGG + Intronic
945088688 2:206159198-206159220 GGCTTCCGAGGCGGCGGGGCGGG + Intronic
1169171715 20:3470887-3470909 GTCTCCGGCGTCCGCGGCGCCGG - Intergenic
1171499851 20:25585250-25585272 GTCGCCCTCGAGGGCGGGGCGGG - Intronic
1174186092 20:48707298-48707320 CTCTCCAGCCTCGGCTGGGCAGG + Intronic
1175074056 20:56358962-56358984 GCCTCCCGGGTCAGCGGCGCGGG + Exonic
1175911403 20:62407011-62407033 GGCTCCGGCGGCGGCGGCGCTGG + Exonic
1176131620 20:63498899-63498921 GGTCCCCGCGTCGGCCGGGCTGG - Intronic
1176162068 20:63653152-63653174 GTCTGCGGCGCCGGCGGGGCTGG - Intronic
1176546835 21:8205881-8205903 GTGTCGCGCGTCGCCTGGGCCGG + Intergenic
1176554740 21:8250090-8250112 GTGTCGCGCGTCGCCTGGGCCGG + Intergenic
1176565786 21:8388928-8388950 GTGTCGCGCGTCGCCTGGGCCGG + Intergenic
1176573661 21:8433115-8433137 GTGTCGCGCGTCGCCTGGGCCGG + Intergenic
1179874684 21:44261945-44261967 GTGTCCCGCGGGGGCGGGGAGGG + Exonic
1185055047 22:48575197-48575219 GTCTCCCGCGCCAGCAGGGCCGG + Intronic
1203251710 22_KI270733v1_random:122166-122188 GTGTCGCGCGTCGCCTGGGCCGG + Intergenic
1203259760 22_KI270733v1_random:167248-167270 GTGTCGCGCGTCGCCTGGGCCGG + Intergenic
950024813 3:9812989-9813011 GTCTCTTGCGCCGGAGGGGCTGG + Exonic
950134381 3:10570484-10570506 GTCTCCCCAGTAGGCCGGGCTGG + Intronic
950664193 3:14485009-14485031 CTCTCTCGGGTCGACGGGGCCGG + Exonic
960684705 3:120285099-120285121 GTCTCGCGCGTTCGCGGGGCTGG + Intergenic
965757611 3:172040855-172040877 GTCTCCCGAGACGGCGGGCCCGG - Intronic
968434109 4:576195-576217 GGCTCCGGCGGCGGCGGCGCGGG - Intergenic
968701883 4:2061313-2061335 GCCTCCGGTGTCAGCGGGGCTGG + Intronic
970332788 4:15002872-15002894 GTCCCCCTCGGCGGCGGCGCGGG + Exonic
973760191 4:54108483-54108505 GGCTCCCCCGTCGGTGGCGCCGG + Intronic
983323692 4:166227093-166227115 GCCTCCTGAGTTGGCGGGGCAGG + Intergenic
985150939 4:186946364-186946386 GTCACCTGCGGTGGCGGGGCAGG + Intergenic
985930836 5:3056481-3056503 CTCTCCCCCGGCGGCGGGGAGGG + Intergenic
986695728 5:10353377-10353399 GTCTCGCACGTCGGCTGGGGCGG + Intergenic
986813657 5:11385156-11385178 GGCTCCCGCGGCGGCGGCGGCGG + Exonic
992530233 5:77645705-77645727 GTCTCCCGCGCCGTCGGGCCGGG + Intergenic
1019366907 7:638023-638045 GTCTTCTCCGCCGGCGGGGCAGG - Intronic
1025112419 7:56229873-56229895 GTCTGCAGCGTGAGCGGGGCTGG - Intergenic
1027013724 7:74766600-74766622 GGCTCCCGCGGGGGTGGGGCTGG + Intergenic
1027074314 7:75179432-75179454 GGCTCCCGCGGGGGTGGGGCTGG - Intergenic
1027361795 7:77416578-77416600 GCCTCCCGCCCCGGCGGGCCTGG - Intergenic
1034911791 7:155003333-155003355 AGCTCCCCCCTCGGCGGGGCCGG + Intergenic
1036932735 8:12972284-12972306 GACTCCCGTGGAGGCGGGGCTGG + Intronic
1048214342 8:132481138-132481160 GCCTCCCGCCGCGACGGGGCGGG - Intergenic
1049585085 8:143429307-143429329 GTCCCCGGCGACGGCGGCGCGGG + Exonic
1049845497 8:144798942-144798964 GTCGGCCGCGGCCGCGGGGCGGG + Intronic
1053239859 9:36487202-36487224 CTCCTCCCCGTCGGCGGGGCCGG + Intronic
1055844355 9:80543697-80543719 GTCTCCCTCGTCGCCCAGGCTGG + Intergenic
1060713078 9:125889931-125889953 GTCCCCCGCGCCGGCGGCCCCGG + Intronic
1061975979 9:134068190-134068212 CTCGGCCGGGTCGGCGGGGCGGG - Intronic
1062326067 9:136013162-136013184 GTCTCTCGGGTGGGTGGGGCCGG - Intronic
1203468112 Un_GL000220v1:105317-105339 GTGTCGCGCGTCGCCTGGGCCGG + Intergenic
1203475933 Un_GL000220v1:149289-149311 GTGTCGCGCGTCGCCTGGGCCGG + Intergenic
1188384144 X:29534937-29534959 GTCTCCCTCGTCGCCCAGGCTGG - Intronic
1189821584 X:44873789-44873811 GTCTCTGGCGGCGGCGGGGCGGG + Intronic