ID: 1074843224

View in Genome Browser
Species Human (GRCh38)
Location 10:117375250-117375272
Sequence CGCTGTGGGCGCGGGAGTAG GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 149
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 138}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1074843224_1074843239 27 Left 1074843224 10:117375250-117375272 CCCCTACTCCCGCGCCCACAGCG 0: 1
1: 0
2: 0
3: 10
4: 138
Right 1074843239 10:117375300-117375322 TGCCTCCATTTTGAGGACATCGG 0: 1
1: 0
2: 1
3: 13
4: 180
1074843224_1074843240 28 Left 1074843224 10:117375250-117375272 CCCCTACTCCCGCGCCCACAGCG 0: 1
1: 0
2: 0
3: 10
4: 138
Right 1074843240 10:117375301-117375323 GCCTCCATTTTGAGGACATCGGG 0: 1
1: 0
2: 0
3: 7
4: 131
1074843224_1074843235 20 Left 1074843224 10:117375250-117375272 CCCCTACTCCCGCGCCCACAGCG 0: 1
1: 0
2: 0
3: 10
4: 138
Right 1074843235 10:117375293-117375315 CCCCCGCTGCCTCCATTTTGAGG 0: 1
1: 0
2: 2
3: 14
4: 214

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1074843224 Original CRISPR CGCTGTGGGCGCGGGAGTAG GGG (reversed) Exonic
900624086 1:3600285-3600307 CCCTGTGGGCACAGGAGGAGTGG + Intronic
900786771 1:4654658-4654680 CGCGGTGGGCGCGGGCGGCGGGG + Intergenic
903468313 1:23567995-23568017 CGCGGTGGGTGAGGGAGTGGAGG - Intergenic
904682801 1:32240760-32240782 CGAAGTGGGCGCGGTCGTAGGGG - Intergenic
907427827 1:54392021-54392043 TGGAGTGGGCGCGGGAGGAGAGG - Intronic
908690666 1:66775849-66775871 CACTGTGGTAGCGGGAGAAGGGG + Intronic
910530340 1:88228749-88228771 CGGTGGGGGCGGGGGCGTAGAGG - Intergenic
911912596 1:103654470-103654492 GGCTGTGGGCTCAGGAGAAGGGG + Intergenic
911915858 1:103697478-103697500 GGCTGTGGGCTCAGGAGAAGGGG - Intronic
911920008 1:103748608-103748630 GGCTGTGGGCTCAGGAGAAGGGG + Intronic
915310512 1:155003886-155003908 CGAGGTGGGGGCGGGAGTGGGGG + Intronic
919792750 1:201302750-201302772 CGCTGTGGGGGCGGGAGGGGAGG - Intronic
920033243 1:203049638-203049660 CGGGGTGGGGGCGGGAGTGGGGG - Intronic
920379298 1:205526533-205526555 AGCTGAGGGAGTGGGAGTAGTGG + Intronic
922978999 1:229809222-229809244 GGATGTGGGCAGGGGAGTAGTGG + Intergenic
924179097 1:241423879-241423901 CGCTGTGGGAGCAGCAGTGGCGG + Intergenic
1063453070 10:6164144-6164166 GGTTGAGGGCGCGGGAGAAGTGG + Intronic
1064645243 10:17453886-17453908 CGCTGTGGGCGAGGCAGCTGTGG - Intronic
1066464410 10:35640361-35640383 CGCTGGGGGCGCGGGCGGCGCGG - Exonic
1069863213 10:71484039-71484061 CGCTGTGGCCGTGGGAGGTGTGG - Intronic
1074297386 10:112203096-112203118 CGCTGTGGTAGGGGGAGCAGAGG + Intronic
1074843224 10:117375250-117375272 CGCTGTGGGCGCGGGAGTAGGGG - Exonic
1076648875 10:131973484-131973506 GGCTGTGGTCGCAGGAGGAGCGG - Intronic
1077181610 11:1219534-1219556 CGCTGTGGTCGGGGGAGGGGAGG + Intergenic
1077190515 11:1254264-1254286 TGCTGAGGGCGCGGGGGCAGCGG - Exonic
1078489987 11:11759651-11759673 CTCTGTGGCCGCTGGAGAAGGGG - Intergenic
1079237169 11:18699088-18699110 GGCTGGGGGCGCGCGAGGAGGGG - Intronic
1079407739 11:20160387-20160409 CACTGTGGGGGCGGGAGGGGCGG - Exonic
1083163071 11:60867521-60867543 CTCTGGTGGCGAGGGAGTAGGGG + Intergenic
1085258035 11:75188054-75188076 GGCTGTGGGCTGGGGAGGAGAGG - Intronic
1094681956 12:32674993-32675015 TGCTGTGGGGGAGGGTGTAGGGG - Intergenic
1101428138 12:104604516-104604538 TGCTGTGGGCCAGGGAGTTGAGG + Intronic
1111445816 13:88345400-88345422 CGCGGTGGGTGCGGGAATGGGGG + Intergenic
1115762046 14:36584463-36584485 CGCTGGGGGCTCGGGAGCTGAGG - Intergenic
1118179626 14:63479288-63479310 TGCTGTGGGTGGGGGAGGAGGGG + Intronic
1120387235 14:83862009-83862031 CGCTGTGGATGCTGGAGTGGCGG + Intergenic
1121005533 14:90488392-90488414 CCCTGTGGGACCGGGAGCAGTGG - Intergenic
1124722507 15:32122171-32122193 CGCAGTGGGTGAGGGACTAGTGG + Intronic
1126692619 15:51299438-51299460 AGCTGTGGAGGCAGGAGTAGAGG - Intronic
1129029786 15:72609819-72609841 GGCTGTGGGAGCAGGAGCAGAGG + Intergenic
1131122298 15:89830181-89830203 CGCTGTGGCCGAGGGACAAGAGG - Intergenic
1131188648 15:90295243-90295265 CTCTGTGGGGGCGGGGGTGGGGG + Intronic
1132393330 15:101454605-101454627 GGCTGTGGGGGAGGGAGGAGTGG + Intronic
1132601014 16:772967-772989 CGATCTCGGTGCGGGAGTAGAGG + Exonic
1132760572 16:1506832-1506854 GGCGGTGGGCACGGGAGGAGGGG + Intronic
1134073749 16:11276406-11276428 TGCAGTGGGCCCTGGAGTAGGGG + Exonic
1140472805 16:75224684-75224706 CCCTGTGGGAGAGGGAGAAGGGG - Exonic
1140734787 16:77888682-77888704 CGCTGGCGGTACGGGAGTAGAGG - Intronic
1141527049 16:84618244-84618266 CGCGGTGGGGGCTGGAGTAGGGG + Intergenic
1143633055 17:8149698-8149720 AGCTGTGGGAGAAGGAGTAGGGG + Intronic
1143644527 17:8221743-8221765 AGCCGTGGTCGCGGGTGTAGCGG - Intergenic
1146905486 17:36615200-36615222 TGCTGTGGGCCGGGGAGGAGGGG + Intergenic
1148777020 17:50101698-50101720 GGCGGTGGGGGCGGGAGGAGAGG - Intronic
1156253820 18:35376950-35376972 CGCGGTGGGCGCGGGAGGTCGGG - Intronic
1158139708 18:54242754-54242776 GGCTGTGGGAGCAGCAGTAGTGG - Intergenic
1160699502 19:499017-499039 CGCTGTGGGCAGGGGAGGGGTGG - Intronic
1161015166 19:1979731-1979753 GGCTGTGGGTGAGGGAGCAGGGG - Exonic
1162141121 19:8586171-8586193 TGCTGTGGGCACTGCAGTAGTGG + Exonic
1163415017 19:17181087-17181109 CGCCGGGGTCGCAGGAGTAGTGG - Intronic
1167145901 19:47680763-47680785 CGCTGTGGGCCCCGGAGTGGGGG - Exonic
1168320079 19:55503854-55503876 CGCGGTGGGCCCGGGAATGGAGG + Intronic
1168332409 19:55578274-55578296 GGCTGTAGGCGCGCGAGAAGCGG + Exonic
925607481 2:5673517-5673539 CGCTGTGGCTGCGGGTGCAGCGG - Intergenic
926193063 2:10742628-10742650 GGCTGTGGGTGCGGAAGAAGAGG + Intronic
927052921 2:19348086-19348108 CGCAGTGGGCGCGGCCATAGTGG + Intergenic
927194592 2:20538816-20538838 CCCTGTGGGCTGGGGATTAGGGG + Intergenic
929604095 2:43224221-43224243 TGCTGGGGGCACGGGAGTGGGGG - Exonic
931429549 2:62197202-62197224 GGCTGCGGGCGCGGGACTGGCGG + Intronic
934966810 2:98730965-98730987 CGCGGAGGGCGCGGGAGTTGGGG - Intronic
940006853 2:149016260-149016282 GGCTGTGGGCGTGGAAGCAGTGG + Intronic
945037505 2:205716568-205716590 GGCTGTGGGCGGGGGGGTGGGGG + Intronic
946603118 2:221373185-221373207 CCCAGTGGGCAAGGGAGTAGGGG + Intergenic
948402308 2:237692653-237692675 CGCGGTGGGAGCGGGCGCAGTGG + Intronic
948936255 2:241166877-241166899 CTCTGTGGGCTGGGAAGTAGGGG - Intronic
1171123742 20:22584987-22585009 CGCTGTGGACCCGGGAGGAAAGG - Intronic
1171213068 20:23331697-23331719 CGCTGGGGGCTCTGGAGCAGGGG + Intergenic
1171459840 20:25292248-25292270 CCCTGTGGGAGCGGGAGTGGGGG + Intronic
1173790385 20:45824266-45824288 CGCTGGGGGCCCGGGAGCCGAGG - Intronic
1174180759 20:48672813-48672835 CGGTGTGGGAGCGGGGGCAGGGG - Intronic
1176144198 20:63558308-63558330 CGCAGTGGGCTCGGGGGTTGGGG - Intronic
1178078940 21:29042380-29042402 CCCTGTGGGATGGGGAGTAGGGG - Intronic
1178980882 21:37263914-37263936 CGCTGTGGTTGTGGGAGAAGCGG - Intronic
1179988206 21:44932610-44932632 GGCTGCGGGAGCGGGAGGAGCGG + Intergenic
1180907222 22:19422899-19422921 GGCTGTGGACACGGGAGTAAAGG + Intronic
1183441148 22:37823796-37823818 GGCTGTGGGGGCGGGGGTTGGGG + Intronic
1184332230 22:43834261-43834283 CGGTGTGGGTGCGGGAGTGCCGG - Intronic
1184735980 22:46398081-46398103 CGCGGTGGGGGCGTGAGGAGTGG + Intronic
1185283000 22:49983648-49983670 AGCTGCGGGGGCGGGAGGAGGGG - Intergenic
950230598 3:11272441-11272463 CGCGGCGGGCGAGGGTGTAGTGG + Intronic
950676088 3:14555269-14555291 CGCTGTGTGTGGGGGAGGAGGGG - Intergenic
950730069 3:14948539-14948561 CCCTGGCGGGGCGGGAGTAGAGG + Intronic
954327406 3:49870994-49871016 TGCTGTGGGAGAGGGAGTTGGGG + Intergenic
954404951 3:50340545-50340567 TGCAGTGCGCGCGTGAGTAGTGG - Exonic
959743345 3:109747286-109747308 TTCTGTGGGTGTGGGAGTAGTGG + Intergenic
961305731 3:125958432-125958454 GGCTCTGGGCGCGGGCGTGGCGG - Intergenic
966595871 3:181724379-181724401 CGCTGCCGGCGCGGGTGTACTGG + Intergenic
966799486 3:183749435-183749457 TGCTGGGGGGGCGGGAGGAGTGG - Intronic
966874962 3:184316225-184316247 GGCTGTGGGGAGGGGAGTAGGGG + Intronic
972077003 4:35101998-35102020 GGCTGTGGGCTCAGGAGTAGGGG - Intergenic
976970495 4:91096277-91096299 GGCTGTGGGCTCAGGAGTAGGGG + Intronic
977689925 4:99894566-99894588 CGCGGTGGGCGGGGGAGGGGCGG - Intergenic
977809695 4:101346054-101346076 CGCGGGGGGCGCGGGAGGCGGGG - Intronic
985478411 5:92337-92359 GGGTGGGGGCGCGGGGGTAGGGG + Intergenic
985478440 5:92390-92412 GGGTGGGGGCGCGGGGGTAGGGG + Intergenic
985478479 5:92473-92495 GGGTGGGGGCGCGGGGGTAGGGG + Intergenic
985995621 5:3595653-3595675 CGCGGTGGGCGCGCGCGTCGGGG - Intergenic
986392808 5:7301310-7301332 AGCTGCGGGAGCAGGAGTAGCGG - Intergenic
992474489 5:77088481-77088503 CGGGGTGGGGGCGGGGGTAGAGG + Intergenic
992693341 5:79260331-79260353 AGCTGTGGGAGCGGCAGTGGTGG - Intronic
995734906 5:115289422-115289444 CGCTGGGGTGGCGGGAGGAGCGG - Intronic
996507202 5:124280759-124280781 AGCTGTGAGCGCGGGAGGGGAGG + Intergenic
1001207962 5:169781776-169781798 CTCTGTGGGGGCGGGAGAGGGGG - Intronic
1002061773 5:176629742-176629764 CGCCGCGGTCTCGGGAGTAGGGG - Intronic
1002158796 5:177303125-177303147 CACGGTGGGCGGGGGAGTGGGGG - Intronic
1007257347 6:40538297-40538319 AGCTGGAGGCCCGGGAGTAGGGG - Intronic
1007585737 6:42988132-42988154 CTCTGTGTGGGCTGGAGTAGGGG - Intronic
1013117627 6:107114974-107114996 CGGGGTGGGGGCGGGAGCAGGGG - Intronic
1014808417 6:125857871-125857893 CGCTTTGGGCTCGGGTGCAGTGG - Intronic
1019915757 7:4131247-4131269 CGCTGTGGGAGAGGAAGCAGCGG - Intronic
1020812661 7:12864899-12864921 GGCTGTGGGAGTGGCAGTAGTGG - Intergenic
1024520947 7:50304032-50304054 CGCGGTGCGCGCGGGGGTGGCGG + Intergenic
1028556748 7:92133999-92134021 CGCGCTGGGGGCTGGAGTAGTGG - Intronic
1028987400 7:97018849-97018871 CGCTGGGGGTGCCGGAGGAGGGG + Intergenic
1029019079 7:97345524-97345546 CGCTGTGGGGCCGGGCGCAGTGG + Intergenic
1030033164 7:105387971-105387993 CGCTGCGGGCGCCGGGGTCGCGG - Intronic
1032161229 7:129512345-129512367 CGTTGTGGGCGATGTAGTAGAGG - Exonic
1034963080 7:155374332-155374354 AGCTGGGGGAGCGGGAGCAGGGG + Intergenic
1036708033 8:11059611-11059633 CGCTGGGGGCGCGGGGGGCGCGG + Intronic
1049417126 8:142500317-142500339 CGCGGGGGGCGGGGGAGGAGCGG - Intronic
1049417137 8:142500340-142500362 CGCGGGGGGCGGGGGAGGAGCGG - Intronic
1049452598 8:142670106-142670128 CGCGGAGGGCGTGGGAGGAGAGG + Intronic
1049798066 8:144505554-144505576 CACCGTGGGCGCGGGGGGAGTGG - Intronic
1049798084 8:144505596-144505618 CACCGTGGGCGCGGGGGGAGTGG - Intronic
1049798102 8:144505638-144505660 CACCGTGGGCGCGGGGGGAGTGG - Intronic
1056163547 9:83921265-83921287 GGCTGGGGGCGCGGGAGCGGCGG + Intronic
1056795854 9:89658449-89658471 CCCTGTGGGAGCAGGAGCAGAGG + Intergenic
1057208133 9:93185207-93185229 CGCTGCGGGCGCGGGGGCGGCGG - Exonic
1058058497 9:100473051-100473073 AGCTGTCGGCGCGGGAGCTGGGG + Intronic
1060485939 9:124046011-124046033 CTCTGTGCGCGCGGGTGAAGAGG - Intergenic
1061389057 9:130307187-130307209 TGCTGGGGGCGAGGGAGAAGCGG + Intronic
1061903463 9:133684743-133684765 CATTGTGGGCGTGGGAGGAGGGG - Intronic
1062537597 9:137027765-137027787 CGCTGTGGGCGGGGGGCAAGCGG - Exonic
1193046828 X:77062842-77062864 CACTGTGGGCTGGGGAGTTGTGG - Intergenic
1193421440 X:81287648-81287670 GTCTGTGGGTGGGGGAGTAGGGG + Intronic
1198005633 X:132489863-132489885 CGGGGTGGGCGCGGGAGCCGGGG - Intronic
1198480220 X:137033921-137033943 CGCTGCGGGCGCGGCAGGAGCGG + Intergenic
1198969595 X:142266660-142266682 GGCTGTGGGCTCAGGAGTAGGGG - Intergenic
1201637550 Y:16141592-16141614 GACTGTGGGGGCGGGAGTAGGGG + Intergenic
1201680969 Y:16643311-16643333 GGCTGTGGGCTGAGGAGTAGGGG + Intergenic