ID: 1074848831

View in Genome Browser
Species Human (GRCh38)
Location 10:117422264-117422286
Sequence GTTGCATTGTGACCAACAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1074848831_1074848837 30 Left 1074848831 10:117422264-117422286 CCTCCTGTTGGTCACAATGCAAC No data
Right 1074848837 10:117422317-117422339 TTCAGACCCATCGTGCTCTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1074848831 Original CRISPR GTTGCATTGTGACCAACAGG AGG (reversed) Intergenic
No off target data available for this crispr