ID: 1074855021

View in Genome Browser
Species Human (GRCh38)
Location 10:117467099-117467121
Sequence AACCCTATGGTGACAGTGAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1074855021_1074855023 -8 Left 1074855021 10:117467099-117467121 CCTGTCACTGTCACCATAGGGTT No data
Right 1074855023 10:117467114-117467136 ATAGGGTTTACAAATGCAATAGG No data
1074855021_1074855028 7 Left 1074855021 10:117467099-117467121 CCTGTCACTGTCACCATAGGGTT No data
Right 1074855028 10:117467129-117467151 GCAATAGGGGAGCCTGGAGTGGG No data
1074855021_1074855030 12 Left 1074855021 10:117467099-117467121 CCTGTCACTGTCACCATAGGGTT No data
Right 1074855030 10:117467134-117467156 AGGGGAGCCTGGAGTGGGGATGG No data
1074855021_1074855029 8 Left 1074855021 10:117467099-117467121 CCTGTCACTGTCACCATAGGGTT No data
Right 1074855029 10:117467130-117467152 CAATAGGGGAGCCTGGAGTGGGG No data
1074855021_1074855024 -7 Left 1074855021 10:117467099-117467121 CCTGTCACTGTCACCATAGGGTT No data
Right 1074855024 10:117467115-117467137 TAGGGTTTACAAATGCAATAGGG No data
1074855021_1074855025 -6 Left 1074855021 10:117467099-117467121 CCTGTCACTGTCACCATAGGGTT No data
Right 1074855025 10:117467116-117467138 AGGGTTTACAAATGCAATAGGGG No data
1074855021_1074855027 6 Left 1074855021 10:117467099-117467121 CCTGTCACTGTCACCATAGGGTT No data
Right 1074855027 10:117467128-117467150 TGCAATAGGGGAGCCTGGAGTGG No data
1074855021_1074855026 1 Left 1074855021 10:117467099-117467121 CCTGTCACTGTCACCATAGGGTT No data
Right 1074855026 10:117467123-117467145 ACAAATGCAATAGGGGAGCCTGG No data
1074855021_1074855032 16 Left 1074855021 10:117467099-117467121 CCTGTCACTGTCACCATAGGGTT No data
Right 1074855032 10:117467138-117467160 GAGCCTGGAGTGGGGATGGGAGG No data
1074855021_1074855031 13 Left 1074855021 10:117467099-117467121 CCTGTCACTGTCACCATAGGGTT No data
Right 1074855031 10:117467135-117467157 GGGGAGCCTGGAGTGGGGATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1074855021 Original CRISPR AACCCTATGGTGACAGTGAC AGG (reversed) Intergenic
No off target data available for this crispr