ID: 1074855840

View in Genome Browser
Species Human (GRCh38)
Location 10:117472861-117472883
Sequence CTCAGCAAGGGGTAGGTGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1074855827_1074855840 14 Left 1074855827 10:117472824-117472846 CCGTTCCCCCTGCTCTTGGAGAG No data
Right 1074855840 10:117472861-117472883 CTCAGCAAGGGGTAGGTGGAGGG No data
1074855829_1074855840 9 Left 1074855829 10:117472829-117472851 CCCCCTGCTCTTGGAGAGGAGAT No data
Right 1074855840 10:117472861-117472883 CTCAGCAAGGGGTAGGTGGAGGG No data
1074855826_1074855840 15 Left 1074855826 10:117472823-117472845 CCCGTTCCCCCTGCTCTTGGAGA No data
Right 1074855840 10:117472861-117472883 CTCAGCAAGGGGTAGGTGGAGGG No data
1074855830_1074855840 8 Left 1074855830 10:117472830-117472852 CCCCTGCTCTTGGAGAGGAGATC No data
Right 1074855840 10:117472861-117472883 CTCAGCAAGGGGTAGGTGGAGGG No data
1074855824_1074855840 22 Left 1074855824 10:117472816-117472838 CCACAAGCCCGTTCCCCCTGCTC No data
Right 1074855840 10:117472861-117472883 CTCAGCAAGGGGTAGGTGGAGGG No data
1074855831_1074855840 7 Left 1074855831 10:117472831-117472853 CCCTGCTCTTGGAGAGGAGATCA No data
Right 1074855840 10:117472861-117472883 CTCAGCAAGGGGTAGGTGGAGGG No data
1074855832_1074855840 6 Left 1074855832 10:117472832-117472854 CCTGCTCTTGGAGAGGAGATCAA No data
Right 1074855840 10:117472861-117472883 CTCAGCAAGGGGTAGGTGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1074855840 Original CRISPR CTCAGCAAGGGGTAGGTGGA GGG Intergenic
No off target data available for this crispr