ID: 1074858368

View in Genome Browser
Species Human (GRCh38)
Location 10:117490374-117490396
Sequence TTCTTAAAGCAGTGGCACTA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 145
Summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 134}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1074858368 Original CRISPR TTCTTAAAGCAGTGGCACTA GGG (reversed) Intergenic
900907782 1:5572855-5572877 TTTTTATAGCAGTGGCAAAACGG + Intergenic
902208567 1:14888073-14888095 TCATTAAAGCAGTGGCAATGAGG - Intronic
907419285 1:54336104-54336126 TTCTTCTAGCACTGGCACTCTGG + Intronic
909543702 1:76819563-76819585 TTCTTCAGGCAGTGTCTCTAAGG + Intergenic
910457577 1:87413851-87413873 TTCTTTGAGCAGTGGCTCTCTGG + Intergenic
910610341 1:89134389-89134411 TTCTCAGAGCAGTGGCAGTGGGG - Intronic
914314886 1:146500646-146500668 TTCTTTGAGCAGTGGCTCTCTGG + Intergenic
914499466 1:148232741-148232763 TTCTTTGAGCAGTGGCTCTCTGG - Intergenic
917078463 1:171231596-171231618 TTCTTATTGCAGAGGGACTAAGG - Intergenic
921725970 1:218523755-218523777 TTCTGACAGCACTGGCACTGGGG + Intergenic
924441466 1:244088813-244088835 TTCATACAGCAGTGGCAACAGGG + Intergenic
924674081 1:246157743-246157765 TTCTCAACGCAGTTCCACTAGGG - Intronic
1069172245 10:65246795-65246817 TTCTTAAAGCAGTACAGCTAGGG + Intergenic
1074858368 10:117490374-117490396 TTCTTAAAGCAGTGGCACTAGGG - Intergenic
1075216306 10:120539237-120539259 CTCTAACAGCAGTGGCTCTAGGG - Intronic
1078169699 11:8920210-8920232 ATCTTAAAGCAGTTTCACCAGGG + Exonic
1079373198 11:19869769-19869791 TTCAAAAAGCAGTCTCACTAGGG - Intronic
1081245375 11:40759802-40759824 TCCCTAAAGCAGTTACACTAAGG + Intronic
1086150569 11:83605440-83605462 TTTCTAAAGCAGTGGGACCAGGG + Intronic
1087023469 11:93626517-93626539 TTTTGAAAGCAGTGCCACTGTGG - Intergenic
1087212725 11:95460131-95460153 TTGTAAAAGCAAGGGCACTAGGG + Intergenic
1089009464 11:115120815-115120837 TGCTAGAAGCAGTGGCACTAGGG + Intergenic
1089173511 11:116532548-116532570 TTCTTTAAGCAGAAGCACCAAGG - Intergenic
1091902629 12:4156784-4156806 TTCTGAAATCTGTGGCCCTAGGG + Intergenic
1094022562 12:25929736-25929758 ACCTTAAAGAAGTGGCACTTTGG + Intergenic
1094739541 12:33273191-33273213 TTCATAAAGAAGTGGCATTTTGG - Intergenic
1098867157 12:75775985-75776007 TTTTTAATGCAGTAGCAATATGG - Intergenic
1100101454 12:91111426-91111448 TTCTTAAAGCAGATGCACTATGG + Exonic
1100527530 12:95433540-95433562 TTCCCAAAGCACTGGGACTACGG + Intergenic
1101144923 12:101831568-101831590 TTCGTAAATCAGAGGCACCAAGG - Intergenic
1102100193 12:110272489-110272511 AGTTTAAAGCAGTGGGACTAAGG + Intergenic
1102123319 12:110460442-110460464 TTCTTAACACAATGACACTAAGG + Intronic
1104242357 12:127002347-127002369 ATCTTCAAACATTGGCACTACGG + Intergenic
1105761482 13:23519417-23519439 CTCTTAAAGTATTGCCACTAAGG - Intergenic
1110024261 13:70513839-70513861 TTCCTAAAGCAATGGCAGTAAGG + Intergenic
1110195728 13:72785713-72785735 TTCTTCAATGAGTTGCACTAAGG - Intronic
1115949789 14:38708121-38708143 CTCTTGGAGCAGTGGCACTAAGG + Intergenic
1116167930 14:41357758-41357780 TCATTAAAGCAGTGGGACAAAGG + Intergenic
1116737038 14:48704414-48704436 TTCTTAAAGCATTGTCTTTAAGG + Intergenic
1118358885 14:65039177-65039199 TTCTCAAAGCAGTGTCTGTAGGG + Intronic
1119135471 14:72214376-72214398 TTTTTAAAACAGTGTCAGTATGG - Intronic
1120587777 14:86335951-86335973 TGTTTAAAGCAGTGGCACCATGG - Intergenic
1120741335 14:88111883-88111905 TCCTTTCAGCAGTGGCACTGAGG + Intergenic
1122418617 14:101561869-101561891 TTCTTCAAGCAGGCGCACGAGGG + Exonic
1125430178 15:39585888-39585910 TTCTTAACTCTGTGCCACTAAGG - Intronic
1126574102 15:50181301-50181323 TTCGTACAGAAGTAGCACTAAGG + Intronic
1126713534 15:51487807-51487829 TACTTAAAATAGTGGCACTGTGG - Intronic
1127599366 15:60519954-60519976 TTCTTTGAGCAGTGGCACTGTGG + Intronic
1128777634 15:70335725-70335747 TACTTAAAGCCATGGCACTGTGG - Intergenic
1133382166 16:5340348-5340370 TACTTAAAGCAGTATCATTATGG - Intergenic
1135663260 16:24314929-24314951 TTCTTTATGCAGTGGCCCAAGGG - Intronic
1138616575 16:58172339-58172361 TTCATAAAGCACTGCCACAAAGG - Intronic
1138943351 16:61817013-61817035 CTCTTAATGCATTGACACTATGG + Intronic
1141390970 16:83663246-83663268 TGCTGAAAACAGTGGTACTAGGG - Intronic
1149008768 17:51833133-51833155 TTCTCCCAGCAGAGGCACTAAGG - Intronic
1150247362 17:63686612-63686634 CTCTCAAGGCAGTGGCACAAGGG - Intronic
1152666722 17:81574648-81574670 TTCTGGAAGCAGTGGCGCCAAGG + Intronic
1156201763 18:34841167-34841189 TTTTTATAGCTGTGGGACTAAGG - Intronic
1158451527 18:57570322-57570344 TGCTTAAAGCTGTGGCTCAAGGG - Intronic
1160494137 18:79360328-79360350 TTTTTAAAGCAGTAGCTGTATGG + Intronic
928762706 2:34603635-34603657 TTCATACAGCTGTTGCACTAGGG + Intergenic
929136206 2:38626128-38626150 TTGTTAAAGTAGTGGAATTATGG + Intergenic
929367780 2:41181589-41181611 CATTTAAAGCATTGGCACTATGG + Intergenic
930348194 2:50213417-50213439 TTGTAAAAACAATGGCACTATGG + Intronic
932138440 2:69253329-69253351 TTCATAAGGCAGTGTTACTAAGG - Intergenic
932845385 2:75129852-75129874 AACTTAAAGCAGAGGCACTTGGG + Intronic
934031020 2:88046929-88046951 CTCCCAAAGCAGTGGGACTATGG + Intronic
936870893 2:117133139-117133161 GTATTAAAGCAGTGGCAGTGAGG - Intergenic
940318920 2:152353785-152353807 TTATTAAAGCACTGGCTTTAGGG + Intronic
940664862 2:156596203-156596225 TTTTTAAACTTGTGGCACTATGG - Intronic
943813892 2:192226490-192226512 TTCTTAAAGGATTGGGACAATGG + Intergenic
944789113 2:203105738-203105760 ATCTTAAAGCAGTGCCTATAGGG - Intronic
945848026 2:214971293-214971315 TTGTGAAAGCAGTGTCACTCTGG - Intronic
946977573 2:225170254-225170276 TTCTAAGAGCAGTGGCTCCAAGG + Intergenic
947772200 2:232679455-232679477 CTCTTAAAGCACTGGGATTATGG - Intronic
948041934 2:234909124-234909146 TTCACACAGTAGTGGCACTATGG - Intergenic
948477802 2:238231629-238231651 TTCTTAAAGCACTTGCCCAACGG - Intronic
1169961115 20:11161285-11161307 TTCTTAAAGGTGTGACACTTCGG + Intergenic
1170361627 20:15552776-15552798 TTCTTAAAACAGTGCCAATGAGG - Intronic
1170997885 20:21382181-21382203 TTCTTAAAGGATAGGCACAAGGG - Intronic
1179768152 21:43589955-43589977 TTCCTAAATCAGTGTCACAAAGG - Intronic
1182497210 22:30718022-30718044 TCCTTCAGGCAGTGGCACTTGGG + Intronic
1183546548 22:38457135-38457157 TTCTCAAGGAAGTGGCACTGAGG - Intergenic
949475857 3:4444881-4444903 TTCTTAAAGAAATGGCTTTAAGG + Intronic
949628154 3:5891339-5891361 CTCTTACAGCTGTGGGACTAGGG + Intergenic
956347685 3:68298853-68298875 TTCTTATAGCAGTGTGACAATGG + Intronic
959507109 3:107168772-107168794 CTTTTAAACAAGTGGCACTAAGG - Intergenic
963071404 3:141308354-141308376 TTCCTAAAGCTGAGGCACTGAGG - Intergenic
963639405 3:147839745-147839767 TTCCTAATACTGTGGCACTAGGG + Intergenic
967275115 3:187766723-187766745 TTTTTAAAGCAGTGGTATAAAGG - Intergenic
967728293 3:192882420-192882442 TGCTAAAGGCAGTGACACTAAGG + Intronic
970280551 4:14449955-14449977 TTATTAAGGCTGAGGCACTATGG + Intergenic
970715621 4:18918964-18918986 TTCTTAGTGCATTGGCACAAAGG - Intergenic
976242507 4:82973443-82973465 TGCTTGAATCAGTGGAACTAAGG - Intronic
976809199 4:89082242-89082264 GTCTGAAATCAGTGGCACTTGGG - Intronic
979573554 4:122258816-122258838 TTTTTAATGCAGAGTCACTATGG - Exonic
986493729 5:8320416-8320438 TTCTCAAAGCAGTGGGGCCAGGG - Intergenic
988868167 5:35358305-35358327 TTCTCCAAGCTGAGGCACTAGGG - Intergenic
990136709 5:52653863-52653885 TTCTTAAAGGGGTATCACTAAGG - Intergenic
990952050 5:61308065-61308087 TTCATAAAGCAATGGCATTCTGG - Intergenic
991146783 5:63316285-63316307 TTCTCCAAGCAGTGGGACAAAGG + Intergenic
992411057 5:76505541-76505563 TTCTTAAAGAAATGACCCTAAGG - Intronic
993534085 5:89059854-89059876 TTCTTAAAGTAGTGTCACTTAGG + Intergenic
996761984 5:126995416-126995438 TTATGAAAGCAGTGGCACCCAGG - Intronic
999903688 5:156115477-156115499 TACTTAAAGAAGTGTTACTATGG - Intronic
1001686079 5:173595958-173595980 TGTTTATAGCAGTGGCACTGAGG + Intergenic
1004747681 6:18527714-18527736 TTTTGAAAGCCGTGGCACAAAGG - Intergenic
1006040193 6:31246140-31246162 TGCTGAAGGCAGTGGGACTATGG - Intergenic
1007068580 6:39017999-39018021 TTCATCAAACAGTGGCACTGGGG - Intronic
1007897484 6:45377759-45377781 TTCTTAAAGCAGAGGTTGTAGGG - Exonic
1008615532 6:53222174-53222196 TTCTTAAAACAATTGCACTGGGG - Intergenic
1012912130 6:105130100-105130122 TTCTTAAAGTAGTAGAATTATGG - Intronic
1014546460 6:122741967-122741989 TTCTCAAAGCAGGGGAAATAAGG - Intergenic
1016085169 6:139904542-139904564 TTCTAAAAACAGTGGCTTTAAGG + Intergenic
1023476803 7:40588712-40588734 ATCTTAAAATAGTGTCACTAGGG + Intronic
1024589617 7:50870056-50870078 TTTTTAAAGCAGTTCCACTAGGG + Intergenic
1027198224 7:76046159-76046181 TTCTCAAAGGAGGGGCACTAGGG - Intronic
1028263299 7:88690578-88690600 TTGTTAAAACAGTTGCATTAAGG - Intergenic
1030550873 7:110958031-110958053 TTTTTAAATGAATGGCACTAAGG + Intronic
1030782062 7:113613140-113613162 TTCTTAAAGAATTTGTACTATGG + Intergenic
1033170869 7:139082880-139082902 TTTTTAAAGAAATGGCACTGAGG + Intronic
1042546509 8:69956043-69956065 TTCTAAGGGCAGTGGCACTTTGG + Intergenic
1042954316 8:74232713-74232735 TTATTAACTCAGTGGCATTAAGG + Intergenic
1043801242 8:84612860-84612882 TTCTTTGTGCAGTGTCACTATGG - Intronic
1044313887 8:90727110-90727132 TTCATAACGCAGTGGCAGCAGGG - Intronic
1046231768 8:111367330-111367352 TTCTTAATGCTGTTGCATTAAGG + Intergenic
1050665182 9:7927757-7927779 TTCTTATAGCAGTGGTGTTAGGG + Intergenic
1051973803 9:22924055-22924077 TTATTAAAGCAGAGGCATGAAGG + Intergenic
1052935186 9:34087190-34087212 TTCTTACTGCAGTGGGACTTGGG - Exonic
1055804970 9:80082444-80082466 TTCTAAAAGCAGTGGCTGTAAGG - Intergenic
1057977943 9:99626756-99626778 TTTTTAAAGAAGAGGCAGTATGG - Intergenic
1058367486 9:104226653-104226675 ATGTTAAAGTTGTGGCACTAAGG - Intergenic
1193352797 X:80481976-80481998 TGCTCAATTCAGTGGCACTAAGG + Intergenic
1193760026 X:85453149-85453171 TTCTTCAAGTAGTGGGATTATGG - Intergenic
1194653551 X:96544315-96544337 TTCTCAAAGCACTGGGATTATGG + Intergenic
1195296996 X:103489185-103489207 ATTTTAAAGCAGTTGCATTATGG + Intergenic
1197723669 X:129761562-129761584 CTCCCAAAGCAGTGGGACTATGG - Intronic
1198347537 X:135773535-135773557 TTCTTAAAGTTGTGGAACTGAGG + Intergenic
1198349442 X:135790796-135790818 TTCTTAAAGTTGTGGAACTGAGG + Intergenic
1198351347 X:135808069-135808091 TTCTTAAAGTTGTGGAACTGAGG + Intergenic
1198353256 X:135825335-135825357 TTCTTAAAGTTGTGGAACTGAGG + Intergenic
1198355163 X:135842589-135842611 TTCTTAAAGTTGTGGAACTGAGG + Intergenic
1198357073 X:135859872-135859894 TTCTTAAAGTTGTGGAACTGAGG + Intergenic
1198358987 X:135877151-135877173 TTCTTAAAGTTGTGGAACTGAGG + Intergenic
1198365460 X:135935382-135935404 TTCTTAAAGTTGTGGAACTGAGG + Intergenic