ID: 1074858413

View in Genome Browser
Species Human (GRCh38)
Location 10:117490752-117490774
Sequence GGGTCCTGGCATGCATCTTC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1074858405_1074858413 8 Left 1074858405 10:117490721-117490743 CCTCTCTGTTGCTTCCTGGCAGT No data
Right 1074858413 10:117490752-117490774 GGGTCCTGGCATGCATCTTCTGG No data
1074858408_1074858413 -6 Left 1074858408 10:117490735-117490757 CCTGGCAGTGCCACCCAGGGTCC No data
Right 1074858413 10:117490752-117490774 GGGTCCTGGCATGCATCTTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1074858413 Original CRISPR GGGTCCTGGCATGCATCTTC TGG Intergenic
No off target data available for this crispr