ID: 1074859267

View in Genome Browser
Species Human (GRCh38)
Location 10:117497949-117497971
Sequence GATGTTCTCTGAGGTCTATC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1074859267_1074859274 8 Left 1074859267 10:117497949-117497971 CCTGATAGACCTCAGAGAACATC No data
Right 1074859274 10:117497980-117498002 CGCTCCGTGTTGACAGATGGGGG No data
1074859267_1074859273 7 Left 1074859267 10:117497949-117497971 CCTGATAGACCTCAGAGAACATC No data
Right 1074859273 10:117497979-117498001 CCGCTCCGTGTTGACAGATGGGG No data
1074859267_1074859278 27 Left 1074859267 10:117497949-117497971 CCTGATAGACCTCAGAGAACATC No data
Right 1074859278 10:117497999-117498021 GGGGAGCTGAGGCCCAGAGAGGG No data
1074859267_1074859270 5 Left 1074859267 10:117497949-117497971 CCTGATAGACCTCAGAGAACATC No data
Right 1074859270 10:117497977-117497999 CACCGCTCCGTGTTGACAGATGG No data
1074859267_1074859271 6 Left 1074859267 10:117497949-117497971 CCTGATAGACCTCAGAGAACATC No data
Right 1074859271 10:117497978-117498000 ACCGCTCCGTGTTGACAGATGGG No data
1074859267_1074859277 26 Left 1074859267 10:117497949-117497971 CCTGATAGACCTCAGAGAACATC No data
Right 1074859277 10:117497998-117498020 GGGGGAGCTGAGGCCCAGAGAGG No data
1074859267_1074859276 16 Left 1074859267 10:117497949-117497971 CCTGATAGACCTCAGAGAACATC No data
Right 1074859276 10:117497988-117498010 GTTGACAGATGGGGGAGCTGAGG No data
1074859267_1074859279 28 Left 1074859267 10:117497949-117497971 CCTGATAGACCTCAGAGAACATC No data
Right 1074859279 10:117498000-117498022 GGGAGCTGAGGCCCAGAGAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1074859267 Original CRISPR GATGTTCTCTGAGGTCTATC AGG (reversed) Intergenic