ID: 1074859270

View in Genome Browser
Species Human (GRCh38)
Location 10:117497977-117497999
Sequence CACCGCTCCGTGTTGACAGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1074859267_1074859270 5 Left 1074859267 10:117497949-117497971 CCTGATAGACCTCAGAGAACATC No data
Right 1074859270 10:117497977-117497999 CACCGCTCCGTGTTGACAGATGG No data
1074859265_1074859270 14 Left 1074859265 10:117497940-117497962 CCCTGGTGACCTGATAGACCTCA No data
Right 1074859270 10:117497977-117497999 CACCGCTCCGTGTTGACAGATGG No data
1074859268_1074859270 -4 Left 1074859268 10:117497958-117497980 CCTCAGAGAACATCTAGTCCACC No data
Right 1074859270 10:117497977-117497999 CACCGCTCCGTGTTGACAGATGG No data
1074859266_1074859270 13 Left 1074859266 10:117497941-117497963 CCTGGTGACCTGATAGACCTCAG No data
Right 1074859270 10:117497977-117497999 CACCGCTCCGTGTTGACAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1074859270 Original CRISPR CACCGCTCCGTGTTGACAGA TGG Intergenic