ID: 1074859278

View in Genome Browser
Species Human (GRCh38)
Location 10:117497999-117498021
Sequence GGGGAGCTGAGGCCCAGAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1074859275_1074859278 -8 Left 1074859275 10:117497984-117498006 CCGTGTTGACAGATGGGGGAGCT No data
Right 1074859278 10:117497999-117498021 GGGGAGCTGAGGCCCAGAGAGGG No data
1074859272_1074859278 -3 Left 1074859272 10:117497979-117498001 CCGCTCCGTGTTGACAGATGGGG No data
Right 1074859278 10:117497999-117498021 GGGGAGCTGAGGCCCAGAGAGGG No data
1074859267_1074859278 27 Left 1074859267 10:117497949-117497971 CCTGATAGACCTCAGAGAACATC No data
Right 1074859278 10:117497999-117498021 GGGGAGCTGAGGCCCAGAGAGGG No data
1074859269_1074859278 0 Left 1074859269 10:117497976-117497998 CCACCGCTCCGTGTTGACAGATG No data
Right 1074859278 10:117497999-117498021 GGGGAGCTGAGGCCCAGAGAGGG No data
1074859268_1074859278 18 Left 1074859268 10:117497958-117497980 CCTCAGAGAACATCTAGTCCACC No data
Right 1074859278 10:117497999-117498021 GGGGAGCTGAGGCCCAGAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1074859278 Original CRISPR GGGGAGCTGAGGCCCAGAGA GGG Intergenic