ID: 1074859279

View in Genome Browser
Species Human (GRCh38)
Location 10:117498000-117498022
Sequence GGGAGCTGAGGCCCAGAGAG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1074859267_1074859279 28 Left 1074859267 10:117497949-117497971 CCTGATAGACCTCAGAGAACATC No data
Right 1074859279 10:117498000-117498022 GGGAGCTGAGGCCCAGAGAGGGG No data
1074859272_1074859279 -2 Left 1074859272 10:117497979-117498001 CCGCTCCGTGTTGACAGATGGGG No data
Right 1074859279 10:117498000-117498022 GGGAGCTGAGGCCCAGAGAGGGG No data
1074859275_1074859279 -7 Left 1074859275 10:117497984-117498006 CCGTGTTGACAGATGGGGGAGCT No data
Right 1074859279 10:117498000-117498022 GGGAGCTGAGGCCCAGAGAGGGG No data
1074859268_1074859279 19 Left 1074859268 10:117497958-117497980 CCTCAGAGAACATCTAGTCCACC No data
Right 1074859279 10:117498000-117498022 GGGAGCTGAGGCCCAGAGAGGGG No data
1074859269_1074859279 1 Left 1074859269 10:117497976-117497998 CCACCGCTCCGTGTTGACAGATG No data
Right 1074859279 10:117498000-117498022 GGGAGCTGAGGCCCAGAGAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1074859279 Original CRISPR GGGAGCTGAGGCCCAGAGAG GGG Intergenic