ID: 1074862817

View in Genome Browser
Species Human (GRCh38)
Location 10:117525152-117525174
Sequence CTGGATCTCTTGGGTAAAAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1074862817_1074862824 -4 Left 1074862817 10:117525152-117525174 CCAGTTTTACCCAAGAGATCCAG No data
Right 1074862824 10:117525171-117525193 CCAGAGGCAGAGAGTGGAGAGGG No data
1074862817_1074862821 -10 Left 1074862817 10:117525152-117525174 CCAGTTTTACCCAAGAGATCCAG No data
Right 1074862821 10:117525165-117525187 AGAGATCCAGAGGCAGAGAGTGG No data
1074862817_1074862828 29 Left 1074862817 10:117525152-117525174 CCAGTTTTACCCAAGAGATCCAG No data
Right 1074862828 10:117525204-117525226 ATCTATTCTGAGTCCAGTTCTGG No data
1074862817_1074862829 30 Left 1074862817 10:117525152-117525174 CCAGTTTTACCCAAGAGATCCAG No data
Right 1074862829 10:117525205-117525227 TCTATTCTGAGTCCAGTTCTGGG No data
1074862817_1074862822 -5 Left 1074862817 10:117525152-117525174 CCAGTTTTACCCAAGAGATCCAG No data
Right 1074862822 10:117525170-117525192 TCCAGAGGCAGAGAGTGGAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1074862817 Original CRISPR CTGGATCTCTTGGGTAAAAC TGG (reversed) Intergenic
No off target data available for this crispr