ID: 1074864017

View in Genome Browser
Species Human (GRCh38)
Location 10:117534791-117534813
Sequence CTCGGAGGCCTCCTCTACGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1074864017_1074864027 23 Left 1074864017 10:117534791-117534813 CCAGCGTAGAGGAGGCCTCCGAG No data
Right 1074864027 10:117534837-117534859 CGAGTCCCCAGAGGCTCCCTCGG No data
1074864017_1074864026 14 Left 1074864017 10:117534791-117534813 CCAGCGTAGAGGAGGCCTCCGAG No data
Right 1074864026 10:117534828-117534850 CGGCTGCTGCGAGTCCCCAGAGG No data
1074864017_1074864022 -6 Left 1074864017 10:117534791-117534813 CCAGCGTAGAGGAGGCCTCCGAG No data
Right 1074864022 10:117534808-117534830 TCCGAGGCCCAAGCGGGCTTCGG No data
1074864017_1074864028 24 Left 1074864017 10:117534791-117534813 CCAGCGTAGAGGAGGCCTCCGAG No data
Right 1074864028 10:117534838-117534860 GAGTCCCCAGAGGCTCCCTCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1074864017 Original CRISPR CTCGGAGGCCTCCTCTACGC TGG (reversed) Intergenic
No off target data available for this crispr