ID: 1074864512

View in Genome Browser
Species Human (GRCh38)
Location 10:117537098-117537120
Sequence CCTCCGGTGATGTGGGGCCG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1074864512_1074864523 2 Left 1074864512 10:117537098-117537120 CCACGGCCCCACATCACCGGAGG No data
Right 1074864523 10:117537123-117537145 CCAGGCTGCCCCGGGATGGATGG No data
1074864512_1074864524 3 Left 1074864512 10:117537098-117537120 CCACGGCCCCACATCACCGGAGG No data
Right 1074864524 10:117537124-117537146 CAGGCTGCCCCGGGATGGATGGG No data
1074864512_1074864521 -2 Left 1074864512 10:117537098-117537120 CCACGGCCCCACATCACCGGAGG No data
Right 1074864521 10:117537119-117537141 GGAGCCAGGCTGCCCCGGGATGG No data
1074864512_1074864520 -6 Left 1074864512 10:117537098-117537120 CCACGGCCCCACATCACCGGAGG No data
Right 1074864520 10:117537115-117537137 CGGAGGAGCCAGGCTGCCCCGGG No data
1074864512_1074864529 22 Left 1074864512 10:117537098-117537120 CCACGGCCCCACATCACCGGAGG No data
Right 1074864529 10:117537143-117537165 TGGGGTCCGCGCGCTCCGAGAGG No data
1074864512_1074864525 4 Left 1074864512 10:117537098-117537120 CCACGGCCCCACATCACCGGAGG No data
Right 1074864525 10:117537125-117537147 AGGCTGCCCCGGGATGGATGGGG No data
1074864512_1074864532 28 Left 1074864512 10:117537098-117537120 CCACGGCCCCACATCACCGGAGG No data
Right 1074864532 10:117537149-117537171 CCGCGCGCTCCGAGAGGAATGGG No data
1074864512_1074864530 27 Left 1074864512 10:117537098-117537120 CCACGGCCCCACATCACCGGAGG No data
Right 1074864530 10:117537148-117537170 TCCGCGCGCTCCGAGAGGAATGG No data
1074864512_1074864519 -7 Left 1074864512 10:117537098-117537120 CCACGGCCCCACATCACCGGAGG No data
Right 1074864519 10:117537114-117537136 CCGGAGGAGCCAGGCTGCCCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1074864512 Original CRISPR CCTCCGGTGATGTGGGGCCG TGG (reversed) Intergenic
No off target data available for this crispr