ID: 1074864514

View in Genome Browser
Species Human (GRCh38)
Location 10:117537104-117537126
Sequence CTGGCTCCTCCGGTGATGTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1074864514_1074864523 -4 Left 1074864514 10:117537104-117537126 CCCCACATCACCGGAGGAGCCAG No data
Right 1074864523 10:117537123-117537145 CCAGGCTGCCCCGGGATGGATGG No data
1074864514_1074864530 21 Left 1074864514 10:117537104-117537126 CCCCACATCACCGGAGGAGCCAG No data
Right 1074864530 10:117537148-117537170 TCCGCGCGCTCCGAGAGGAATGG No data
1074864514_1074864529 16 Left 1074864514 10:117537104-117537126 CCCCACATCACCGGAGGAGCCAG No data
Right 1074864529 10:117537143-117537165 TGGGGTCCGCGCGCTCCGAGAGG No data
1074864514_1074864532 22 Left 1074864514 10:117537104-117537126 CCCCACATCACCGGAGGAGCCAG No data
Right 1074864532 10:117537149-117537171 CCGCGCGCTCCGAGAGGAATGGG No data
1074864514_1074864525 -2 Left 1074864514 10:117537104-117537126 CCCCACATCACCGGAGGAGCCAG No data
Right 1074864525 10:117537125-117537147 AGGCTGCCCCGGGATGGATGGGG No data
1074864514_1074864521 -8 Left 1074864514 10:117537104-117537126 CCCCACATCACCGGAGGAGCCAG No data
Right 1074864521 10:117537119-117537141 GGAGCCAGGCTGCCCCGGGATGG No data
1074864514_1074864524 -3 Left 1074864514 10:117537104-117537126 CCCCACATCACCGGAGGAGCCAG No data
Right 1074864524 10:117537124-117537146 CAGGCTGCCCCGGGATGGATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1074864514 Original CRISPR CTGGCTCCTCCGGTGATGTG GGG (reversed) Intergenic