ID: 1074864519

View in Genome Browser
Species Human (GRCh38)
Location 10:117537114-117537136
Sequence CCGGAGGAGCCAGGCTGCCC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1074864512_1074864519 -7 Left 1074864512 10:117537098-117537120 CCACGGCCCCACATCACCGGAGG No data
Right 1074864519 10:117537114-117537136 CCGGAGGAGCCAGGCTGCCCCGG No data
1074864507_1074864519 14 Left 1074864507 10:117537077-117537099 CCAGTGAAGCCCAAGCGGATTCC No data
Right 1074864519 10:117537114-117537136 CCGGAGGAGCCAGGCTGCCCCGG No data
1074864509_1074864519 5 Left 1074864509 10:117537086-117537108 CCCAAGCGGATTCCACGGCCCCA No data
Right 1074864519 10:117537114-117537136 CCGGAGGAGCCAGGCTGCCCCGG No data
1074864510_1074864519 4 Left 1074864510 10:117537087-117537109 CCAAGCGGATTCCACGGCCCCAC No data
Right 1074864519 10:117537114-117537136 CCGGAGGAGCCAGGCTGCCCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1074864519 Original CRISPR CCGGAGGAGCCAGGCTGCCC CGG Intergenic